Incidental Mutation 'R5491:Neurod4'
ID432090
Institutional Source Beutler Lab
Gene Symbol Neurod4
Ensembl Gene ENSMUSG00000048015
Gene Nameneurogenic differentiation 4
SynonymsbHLHa4, MATH-3, Atoh3, Math3
MMRRC Submission 043052-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock #R5491 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location130268152-130280240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130271067 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 113 (V113I)
Ref Sequence ENSEMBL: ENSMUSP00000051379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061571]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061571
AA Change: V113I

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051379
Gene: ENSMUSG00000048015
AA Change: V113I

DomainStartEndE-ValueType
low complexity region 49 76 N/A INTRINSIC
HLH 93 145 2.21e-16 SMART
Pfam:Neuro_bHLH 146 263 1.3e-41 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the neurogenic differentiation factor family and encodes a basic helix-loop-helix (bHLH) transcription factor which is expressed in the developing nervous system with high levels of expression in the brain, retina and cranial ganglions. Expression gradually becomes restricted to the neural retina. It is a key gene in the Ngn2-regulated neuronal differentiation pathway, coordinating the onset of cortical gene transcription. This gene also regulates amacrine cell fate determination in the retina. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, ataxia, and high postnatal mortality. Mutants show impaired postnatal cerebellar development, with thinner inner granular cell and molecular layers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik C A 15: 84,406,510 V199L probably benign Het
A1cf G T 19: 31,918,062 A182S possibly damaging Het
Aldh1l2 A T 10: 83,522,785 D2E probably benign Het
Bach2 G T 4: 32,562,681 D383Y probably damaging Het
Cd248 T C 19: 5,070,209 L695P probably damaging Het
Cela1 T A 15: 100,682,980 N132Y probably damaging Het
Cisd2 A T 3: 135,408,840 D123E probably damaging Het
Col6a6 T A 9: 105,738,236 D1571V probably damaging Het
Fam71e2 T C 7: 4,757,926 I596V probably benign Het
Fbxo48 C T 11: 16,954,280 T144M probably damaging Het
Fbxo7 C A 10: 86,048,026 P497Q probably damaging Het
Gm12695 T A 4: 96,769,668 H88L possibly damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gpat4 A G 8: 23,180,664 I133T probably benign Het
Hmcn1 C T 1: 150,609,825 probably null Het
Ncaph T C 2: 127,123,675 T252A probably benign Het
Nebl G T 2: 17,434,972 Y163* probably null Het
Olfr1305 T A 2: 111,873,562 I98F probably benign Het
Olfr411 A T 11: 74,346,914 H103Q probably benign Het
Olfr71 A G 4: 43,705,990 S193P probably damaging Het
Pbxip1 T A 3: 89,443,159 M37K probably benign Het
Phactr2 T C 10: 13,261,846 N184S possibly damaging Het
Phf20l1 C T 15: 66,615,785 P480L possibly damaging Het
Psme4 T C 11: 30,815,246 S538P possibly damaging Het
Rassf1 T A 9: 107,561,415 M228K possibly damaging Het
Rpn2 A G 2: 157,297,383 D231G probably damaging Het
She A T 3: 89,831,790 D96V probably damaging Het
Tmem260 T A 14: 48,512,170 probably null Het
Ttn T A 2: 76,732,358 I28751F probably damaging Het
Zfp60 T G 7: 27,748,515 probably null Het
Other mutations in Neurod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Neurod4 APN 10 130270814 missense probably damaging 0.96
IGL01674:Neurod4 APN 10 130271018 missense probably damaging 1.00
R0347:Neurod4 UTSW 10 130271111 missense probably damaging 1.00
R1436:Neurod4 UTSW 10 130270671 missense possibly damaging 0.87
R1467:Neurod4 UTSW 10 130270604 missense probably benign 0.03
R1467:Neurod4 UTSW 10 130270604 missense probably benign 0.03
R1965:Neurod4 UTSW 10 130271049 nonsense probably null
R3018:Neurod4 UTSW 10 130270955 missense probably damaging 1.00
R3847:Neurod4 UTSW 10 130270482 missense probably benign
R5655:Neurod4 UTSW 10 130271133 nonsense probably null
R5705:Neurod4 UTSW 10 130271402 start codon destroyed probably null 0.99
R6143:Neurod4 UTSW 10 130271000 missense probably damaging 1.00
R6800:Neurod4 UTSW 10 130270792 nonsense probably null
R6867:Neurod4 UTSW 10 130270714 missense probably damaging 1.00
R7396:Neurod4 UTSW 10 130271022 missense probably damaging 1.00
R7401:Neurod4 UTSW 10 130271058 missense probably damaging 1.00
R7961:Neurod4 UTSW 10 130270487 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TAGATTGAGGCCCCAGTTGG -3'
(R):5'- GCTCGGAACCTTAACTGAAGAG -3'

Sequencing Primer
(F):5'- GCATCCAGCAACCAGGTTG -3'
(R):5'- TCGGAACCTTAACTGAAGAGCATGAC -3'
Posted On2016-10-05