Mutagenetix > Incidental Mutations

Incidental Mutation 'R5491:Phf20l1'

432095

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

043052-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.358) question?

Stock #

R5491 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 66615785 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 480 (P480L)

Ref Sequence

ENSEMBL: ENSMUSP00000155465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]

Predicted Effect

probably benign
Transcript: ENSMUST00000048188
AA Change: P507L

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: P507L

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229160
AA Change: P506L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229486

Predicted Effect

probably benign
Transcript: ENSMUST00000229576
AA Change: P507L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229590

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230250

Predicted Effect

probably benign
Transcript: ENSMUST00000230882

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230915

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230948
AA Change: P480L

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 95.0%
20x: 89.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	C	A	15: 84,406,510	V199L	probably benign	Het
A1cf	G	T	19: 31,918,062	A182S	possibly damaging	Het
Aldh1l2	A	T	10: 83,522,785	D2E	probably benign	Het
Bach2	G	T	4: 32,562,681	D383Y	probably damaging	Het
Cd248	T	C	19: 5,070,209	L695P	probably damaging	Het
Cela1	T	A	15: 100,682,980	N132Y	probably damaging	Het
Cisd2	A	T	3: 135,408,840	D123E	probably damaging	Het
Col6a6	T	A	9: 105,738,236	D1571V	probably damaging	Het
Fam71e2	T	C	7: 4,757,926	I596V	probably benign	Het
Fbxo48	C	T	11: 16,954,280	T144M	probably damaging	Het
Fbxo7	C	A	10: 86,048,026	P497Q	probably damaging	Het
Gm12695	T	A	4: 96,769,668	H88L	possibly damaging	Het
Gm8994	C	G	6: 136,329,557	R339G	probably damaging	Het
Gpat4	A	G	8: 23,180,664	I133T	probably benign	Het
Hmcn1	C	T	1: 150,609,825		probably null	Het
Ncaph	T	C	2: 127,123,675	T252A	probably benign	Het
Nebl	G	T	2: 17,434,972	Y163*	probably null	Het
Neurod4	C	T	10: 130,271,067	V113I	possibly damaging	Het
Olfr1305	T	A	2: 111,873,562	I98F	probably benign	Het
Olfr411	A	T	11: 74,346,914	H103Q	probably benign	Het
Olfr71	A	G	4: 43,705,990	S193P	probably damaging	Het
Pbxip1	T	A	3: 89,443,159	M37K	probably benign	Het
Phactr2	T	C	10: 13,261,846	N184S	possibly damaging	Het
Psme4	T	C	11: 30,815,246	S538P	possibly damaging	Het
Rassf1	T	A	9: 107,561,415	M228K	possibly damaging	Het
Rpn2	A	G	2: 157,297,383	D231G	probably damaging	Het
She	A	T	3: 89,831,790	D96V	probably damaging	Het
Tmem260	T	A	14: 48,512,170		probably null	Het
Ttn	T	A	2: 76,732,358	I28751F	probably damaging	Het
Zfp60	T	G	7: 27,748,515		probably null	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
Abbreviated	UTSW	15	66632903	critical splice donor site	probably null
curt	UTSW	15	66639948	missense	possibly damaging	0.90
shorthand	UTSW	15	66609547	missense	probably damaging	1.00
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R2360:Phf20l1	UTSW	15	66594920	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6569:Phf20l1	UTSW	15	66629824	missense	probably damaging	1.00
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7991:Phf20l1	UTSW	15	66630919	missense	possibly damaging	0.64
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
R8161:Phf20l1	UTSW	15	66604073	missense	probably damaging	1.00
R8228:Phf20l1	UTSW	15	66639940	missense	possibly damaging	0.81
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTGCACTGATATGAACTGATCGAG -3'
(R):5'- TGTTCAGAGAATACTGACAATGGTC -3'

Sequencing Primer
(F):5'- CGAGTTCCTTTGTGTTAATATGATGG -3'
(R):5'- GAGAAATTCCATCTGAACACAGTAAC -3'

Posted On

2016-10-05