Mutagenetix > Incidental Mutations

Incidental Mutation 'R5491:Phf20l1'

432095

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

043052-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.333) question?

Stock #

R5491 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 66615785 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 480 (P480L)

Ref Sequence

ENSEMBL: ENSMUSP00000155465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]

Predicted Effect

probably benign
Transcript: ENSMUST00000048188
AA Change: P507L

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: P507L

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229160
AA Change: P506L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229486

Predicted Effect

probably benign
Transcript: ENSMUST00000229576
AA Change: P507L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229590

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230250

Predicted Effect

probably benign
Transcript: ENSMUST00000230882

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230915

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230948
AA Change: P480L

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 95.0%
20x: 89.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	C	A	15: 84,406,510	V199L	probably benign	Het
A1cf	G	T	19: 31,918,062	A182S	possibly damaging	Het
Aldh1l2	A	T	10: 83,522,785	D2E	probably benign	Het
Bach2	G	T	4: 32,562,681	D383Y	probably damaging	Het
Cd248	T	C	19: 5,070,209	L695P	probably damaging	Het
Cela1	T	A	15: 100,682,980	N132Y	probably damaging	Het
Cisd2	A	T	3: 135,408,840	D123E	probably damaging	Het
Col6a6	T	A	9: 105,738,236	D1571V	probably damaging	Het
Fam71e2	T	C	7: 4,757,926	I596V	probably benign	Het
Fbxo48	C	T	11: 16,954,280	T144M	probably damaging	Het
Fbxo7	C	A	10: 86,048,026	P497Q	probably damaging	Het
Gm12695	T	A	4: 96,769,668	H88L	possibly damaging	Het
Gm8994	C	G	6: 136,329,557	R339G	probably damaging	Het
Gpat4	A	G	8: 23,180,664	I133T	probably benign	Het
Hmcn1	C	T	1: 150,609,825		probably null	Het
Ncaph	T	C	2: 127,123,675	T252A	probably benign	Het
Nebl	G	T	2: 17,434,972	Y163*	probably null	Het
Neurod4	C	T	10: 130,271,067	V113I	possibly damaging	Het
Olfr1305	T	A	2: 111,873,562	I98F	probably benign	Het
Olfr411	A	T	11: 74,346,914	H103Q	probably benign	Het
Olfr71	A	G	4: 43,705,990	S193P	probably damaging	Het
Pbxip1	T	A	3: 89,443,159	M37K	probably benign	Het
Phactr2	T	C	10: 13,261,846	N184S	possibly damaging	Het
Psme4	T	C	11: 30,815,246	S538P	possibly damaging	Het
Rassf1	T	A	9: 107,561,415	M228K	possibly damaging	Het
Rpn2	A	G	2: 157,297,383	D231G	probably damaging	Het
She	A	T	3: 89,831,790	D96V	probably damaging	Het
Tmem260	T	A	14: 48,512,170		probably null	Het
Ttn	T	A	2: 76,732,358	I28751F	probably damaging	Het
Zfp60	T	G	7: 27,748,515		probably null	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R2360:Phf20l1	UTSW	15	66594920	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6569:Phf20l1	UTSW	15	66629824	missense	probably damaging	1.00
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7946:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTGCACTGATATGAACTGATCGAG -3'
(R):5'- TGTTCAGAGAATACTGACAATGGTC -3'

Sequencing Primer
(F):5'- CGAGTTCCTTTGTGTTAATATGATGG -3'
(R):5'- GAGAAATTCCATCTGAACACAGTAAC -3'

Posted On

2016-10-05