Incidental Mutation 'R0478:Clmn'
ID43210
Institutional Source Beutler Lab
Gene Symbol Clmn
Ensembl Gene ENSMUSG00000021097
Gene Namecalmin
Synonyms
MMRRC Submission 038678-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0478 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104763117-104865076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104785491 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 235 (M235T)
Ref Sequence ENSEMBL: ENSMUSP00000152070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109936] [ENSMUST00000109937] [ENSMUST00000222323] [ENSMUST00000223103] [ENSMUST00000223177] [ENSMUST00000223342]
Predicted Effect probably damaging
Transcript: ENSMUST00000109936
AA Change: M235T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105562
Gene: ENSMUSG00000021097
AA Change: M235T

DomainStartEndE-ValueType
CH 34 137 2.29e-19 SMART
low complexity region 144 168 N/A INTRINSIC
CH 189 286 9.9e-15 SMART
low complexity region 471 482 N/A INTRINSIC
low complexity region 633 650 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 777 801 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
transmembrane domain 996 1013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109937
AA Change: M235T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105563
Gene: ENSMUSG00000021097
AA Change: M235T

DomainStartEndE-ValueType
CH 34 137 2.29e-19 SMART
low complexity region 144 168 N/A INTRINSIC
CH 189 286 9.9e-15 SMART
low complexity region 471 482 N/A INTRINSIC
low complexity region 633 650 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 777 801 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
transmembrane domain 1027 1044 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222412
Predicted Effect probably damaging
Transcript: ENSMUST00000223103
AA Change: M235T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000223177
AA Change: M235T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000223342
AA Change: M235T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.6950 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,562,589 noncoding transcript Het
4930556J24Rik T G 11: 3,976,259 probably benign Het
Acnat1 T G 4: 49,450,901 D70A probably damaging Het
Adnp2 A G 18: 80,129,334 V620A probably benign Het
Aldoart1 T A 4: 72,852,343 H21L probably benign Het
Birc3 A G 9: 7,860,347 V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 probably benign Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dmbt1 A G 7: 131,041,187 E245G possibly damaging Het
Epgn G T 5: 91,031,128 V36L probably benign Het
Ets2 C A 16: 95,716,262 P346Q probably damaging Het
Fam222b T C 11: 78,153,856 L81P probably damaging Het
Fancf A C 7: 51,861,692 L188R probably damaging Het
Fibin T C 2: 110,362,734 D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 probably null Het
Gbp4 T A 5: 105,119,433 Q540L probably benign Het
Greb1l T A 18: 10,509,281 L531Q probably damaging Het
Il5ra A G 6: 106,738,462 V137A probably benign Het
Kif26a G A 12: 112,175,789 A826T probably damaging Het
Kiz T C 2: 146,942,158 V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 G15D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lbp T C 2: 158,317,528 probably benign Het
Mmp25 T C 17: 23,632,782 T318A probably benign Het
Mrpl50 A G 4: 49,514,513 C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 probably null Het
Noc3l A G 19: 38,810,006 probably null Het
Olfr1126 T A 2: 87,458,026 V287E probably damaging Het
Olfr1375 T C 11: 51,048,712 S202P probably benign Het
Pgm5 A T 19: 24,834,869 S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 S350T probably damaging Het
Ptk2b G T 14: 66,213,372 N48K probably damaging Het
Sept3 T C 15: 82,290,806 L172P probably damaging Het
Sirt3 A T 7: 140,878,114 C41S probably benign Het
Sphkap C T 1: 83,278,711 R152H probably damaging Het
St3gal1 T C 15: 67,113,730 Y25C probably damaging Het
Tbc1d31 T C 15: 57,932,536 F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 D43E probably benign Het
Tgm1 G A 14: 55,700,334 Q773* probably null Het
Tmc3 A T 7: 83,622,152 R837S possibly damaging Het
Unc13a A G 8: 71,651,148 V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 V268E probably damaging Het
Zan C T 5: 137,400,526 probably benign Het
Zfp760 G T 17: 21,722,014 E57* probably null Het
Other mutations in Clmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Clmn APN 12 104774551 critical splice acceptor site probably null
IGL01509:Clmn APN 12 104780903 missense probably benign 0.00
IGL01530:Clmn APN 12 104791856 missense probably damaging 1.00
IGL01768:Clmn APN 12 104781719 missense probably damaging 0.99
IGL01779:Clmn APN 12 104782140 missense probably benign 0.04
IGL02139:Clmn APN 12 104781099 missense probably benign 0.01
IGL02157:Clmn APN 12 104781918 missense probably benign 0.00
IGL02519:Clmn APN 12 104791853 missense probably damaging 1.00
IGL02820:Clmn APN 12 104773234 missense probably damaging 0.99
IGL03036:Clmn APN 12 104774523 missense probably damaging 0.97
R0255:Clmn UTSW 12 104781764 missense probably benign
R0739:Clmn UTSW 12 104781017 missense possibly damaging 0.55
R0761:Clmn UTSW 12 104781558 missense probably damaging 0.99
R0834:Clmn UTSW 12 104771826 missense probably damaging 1.00
R0834:Clmn UTSW 12 104771827 missense probably damaging 1.00
R0864:Clmn UTSW 12 104790015 missense possibly damaging 0.94
R1569:Clmn UTSW 12 104781081 missense probably damaging 1.00
R1638:Clmn UTSW 12 104782022 missense probably benign 0.13
R1940:Clmn UTSW 12 104790102 missense probably damaging 1.00
R1974:Clmn UTSW 12 104791862 missense probably damaging 1.00
R2113:Clmn UTSW 12 104780808 missense probably benign
R4815:Clmn UTSW 12 104785566 missense probably damaging 1.00
R4863:Clmn UTSW 12 104797094 missense probably damaging 1.00
R4883:Clmn UTSW 12 104782048 missense probably benign 0.04
R5577:Clmn UTSW 12 104777070 missense probably damaging 1.00
R5853:Clmn UTSW 12 104783902 splice site probably null
R5867:Clmn UTSW 12 104781755 missense probably damaging 0.98
R6041:Clmn UTSW 12 104781872 missense probably benign 0.00
R6093:Clmn UTSW 12 104771956 missense probably benign 0.00
R6233:Clmn UTSW 12 104785455 missense probably damaging 1.00
R6239:Clmn UTSW 12 104780845 missense probably benign 0.00
R6628:Clmn UTSW 12 104773786 missense probably damaging 1.00
R6771:Clmn UTSW 12 104773782 missense probably benign 0.04
R7448:Clmn UTSW 12 104785428 missense possibly damaging 0.90
R7633:Clmn UTSW 12 104782112 missense probably benign
X0028:Clmn UTSW 12 104785402 missense probably benign 0.11
Z1177:Clmn UTSW 12 104781376 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGTTTCCTACCTGGAAGAGCAGACAG -3'
(R):5'- GGTTCACCTTTAGACATGACCATCCC -3'

Sequencing Primer
(F):5'- GGAATCATGGGCAATGCTGA -3'
(R):5'- gcccaagccagaagcatag -3'
Posted On2013-05-23