Incidental Mutation 'R5492:Hltf'
ID432110
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Namehelicase-like transcription factor
SynonymsP113, Snf2l3, Smarca3
MMRRC Submission 043053-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5492 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location20057811-20118490 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 20098067 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
Predicted Effect probably null
Transcript: ENSMUST00000002502
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128127
Predicted Effect probably benign
Transcript: ENSMUST00000143005
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145853
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Abcd2 A G 15: 91,188,973 Y328H probably benign Het
Abcg4 T C 9: 44,278,058 T381A probably benign Het
Adamts12 A G 15: 11,336,298 N1490D probably benign Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Armc8 G T 9: 99,527,131 C169* probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bsn G A 9: 108,112,515 P2013S probably damaging Het
Cdc16 A G 8: 13,763,915 probably null Het
Cmtr1 T A 17: 29,690,342 F408L probably damaging Het
Col4a2 C T 8: 11,438,608 R1104W possibly damaging Het
Drg2 A C 11: 60,461,596 H208P probably damaging Het
Frem3 A T 8: 80,612,677 D533V probably damaging Het
Gm9930 T A 10: 9,534,593 noncoding transcript Het
Haus5 A G 7: 30,658,955 V305A possibly damaging Het
Hint3 C A 10: 30,618,249 R30L probably benign Het
Hmcn2 T A 2: 31,420,306 L3304Q probably benign Het
Hspa2 A G 12: 76,404,534 M1V probably null Het
Htr5b T C 1: 121,527,658 T178A possibly damaging Het
Ighv1-11 A G 12: 114,612,464 S44P probably damaging Het
Larp1b C T 3: 40,969,899 R104W probably damaging Het
Map3k2 A G 18: 32,228,136 T550A probably damaging Het
Map4 T A 9: 110,052,382 S105T possibly damaging Het
Mgam T C 6: 40,756,363 C691R probably damaging Het
Mms19 A G 19: 41,955,831 I310T possibly damaging Het
Myh2 A C 11: 67,180,875 K506T probably benign Het
Ngdn T C 14: 55,023,052 V239A probably benign Het
Plin1 G A 7: 79,725,712 R151* probably null Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rdh16f2 G T 10: 127,866,754 E67* probably null Het
Slc25a36 A C 9: 97,100,206 C25W probably damaging Het
Stk31 G A 6: 49,398,243 A49T probably damaging Het
Tigar T A 6: 127,089,204 T124S possibly damaging Het
Tsn A G 1: 118,304,713 V144A probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp943 T A 17: 21,993,075 C381S probably damaging Het
Zfyve19 A T 2: 119,209,114 probably benign Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20105632 splice site probably benign
IGL01461:Hltf APN 3 20099939 nonsense probably null
IGL01630:Hltf APN 3 20082904 splice site probably benign
IGL01704:Hltf APN 3 20083746 splice site probably benign
IGL02059:Hltf APN 3 20106457 missense probably benign
IGL02105:Hltf APN 3 20092757 missense probably damaging 1.00
IGL02156:Hltf APN 3 20092807 missense possibly damaging 0.61
IGL02870:Hltf APN 3 20099873 missense probably damaging 0.98
IGL02899:Hltf APN 3 20099817 missense probably damaging 1.00
IGL02935:Hltf APN 3 20069051 missense probably damaging 1.00
IGL02950:Hltf APN 3 20076572 missense probably benign 0.07
IGL03082:Hltf APN 3 20064559 splice site probably benign
snarky UTSW 3 20109487 critical splice donor site probably null
R0068:Hltf UTSW 3 20059090 missense probably damaging 1.00
R0787:Hltf UTSW 3 20106446 missense probably damaging 1.00
R0905:Hltf UTSW 3 20108869 critical splice donor site probably null
R0980:Hltf UTSW 3 20091501 missense probably benign 0.00
R1741:Hltf UTSW 3 20086188 missense probably damaging 1.00
R1748:Hltf UTSW 3 20076521 missense probably benign 0.13
R1799:Hltf UTSW 3 20105691 missense probably damaging 1.00
R1976:Hltf UTSW 3 20106446 missense probably damaging 1.00
R2171:Hltf UTSW 3 20059081 missense probably damaging 1.00
R2395:Hltf UTSW 3 20092742 missense probably benign 0.41
R2444:Hltf UTSW 3 20063907 missense possibly damaging 0.66
R3789:Hltf UTSW 3 20069047 missense probably damaging 1.00
R3943:Hltf UTSW 3 20092744 missense probably damaging 1.00
R4719:Hltf UTSW 3 20064701 critical splice donor site probably null
R4793:Hltf UTSW 3 20063950 missense possibly damaging 0.79
R5296:Hltf UTSW 3 20108112 missense probably damaging 0.99
R5449:Hltf UTSW 3 20069083 missense possibly damaging 0.92
R6012:Hltf UTSW 3 20058934 missense probably damaging 1.00
R6157:Hltf UTSW 3 20076496 missense probably benign 0.13
R6254:Hltf UTSW 3 20063829 missense possibly damaging 0.85
R6553:Hltf UTSW 3 20072394 missense probably damaging 0.96
R6616:Hltf UTSW 3 20109487 critical splice donor site probably null
R6696:Hltf UTSW 3 20065306 intron probably null
R6761:Hltf UTSW 3 20083832 critical splice donor site probably null
R6781:Hltf UTSW 3 20098166 missense probably benign 0.00
R7241:Hltf UTSW 3 20065392 missense probably benign 0.07
R7356:Hltf UTSW 3 20109370 missense probably damaging 1.00
R7453:Hltf UTSW 3 20082752 missense possibly damaging 0.81
X0027:Hltf UTSW 3 20067389 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTCAGTGTGTCAAACATTTGC -3'
(R):5'- ATCGTCACTAATGGATCACCTC -3'

Sequencing Primer
(F):5'- AACCTTAGTTAGCCTGGGCCTAG -3'
(R):5'- TGGATCACCTCATAAACTTACTTACC -3'
Posted On2016-10-05