Incidental Mutation 'R5492:Stk31'
ID432114
Institutional Source Beutler Lab
Gene Symbol Stk31
Ensembl Gene ENSMUSG00000023403
Gene Nameserine threonine kinase 31
SynonymsC330007K24Rik
MMRRC Submission 043053-MU
Accession Numbers

Genbank: NM_029916; MGI: 1924735

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5492 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location49395604-49469501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49398243 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 49 (A49T)
Ref Sequence ENSEMBL: ENSMUSP00000132896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024171] [ENSMUST00000163954] [ENSMUST00000172459]
Predicted Effect probably damaging
Transcript: ENSMUST00000024171
AA Change: A49T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024171
Gene: ENSMUSG00000023403
AA Change: A49T

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 768 932 4.6e-9 PFAM
Pfam:Pkinase 794 973 3.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163954
AA Change: A49T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127545
Gene: ENSMUSG00000023403
AA Change: A49T

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 784 922 7.4e-9 PFAM
Pfam:Pkinase 794 940 1.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172459
AA Change: A49T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132896
Gene: ENSMUSG00000023403
AA Change: A49T

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 739 890 5.2e-9 PFAM
Pfam:Pkinase 749 917 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows testis-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display normal embryonic development and spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Abcd2 A G 15: 91,188,973 Y328H probably benign Het
Abcg4 T C 9: 44,278,058 T381A probably benign Het
Adamts12 A G 15: 11,336,298 N1490D probably benign Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Armc8 G T 9: 99,527,131 C169* probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bsn G A 9: 108,112,515 P2013S probably damaging Het
Cdc16 A G 8: 13,763,915 probably null Het
Cmtr1 T A 17: 29,690,342 F408L probably damaging Het
Col4a2 C T 8: 11,438,608 R1104W possibly damaging Het
Drg2 A C 11: 60,461,596 H208P probably damaging Het
Frem3 A T 8: 80,612,677 D533V probably damaging Het
Gm9930 T A 10: 9,534,593 noncoding transcript Het
Haus5 A G 7: 30,658,955 V305A possibly damaging Het
Hint3 C A 10: 30,618,249 R30L probably benign Het
Hltf T A 3: 20,098,067 probably null Het
Hmcn2 T A 2: 31,420,306 L3304Q probably benign Het
Hspa2 A G 12: 76,404,534 M1V probably null Het
Htr5b T C 1: 121,527,658 T178A possibly damaging Het
Ighv1-11 A G 12: 114,612,464 S44P probably damaging Het
Larp1b C T 3: 40,969,899 R104W probably damaging Het
Map3k2 A G 18: 32,228,136 T550A probably damaging Het
Map4 T A 9: 110,052,382 S105T possibly damaging Het
Mgam T C 6: 40,756,363 C691R probably damaging Het
Mms19 A G 19: 41,955,831 I310T possibly damaging Het
Myh2 A C 11: 67,180,875 K506T probably benign Het
Ngdn T C 14: 55,023,052 V239A probably benign Het
Plin1 G A 7: 79,725,712 R151* probably null Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rdh16f2 G T 10: 127,866,754 E67* probably null Het
Slc25a36 A C 9: 97,100,206 C25W probably damaging Het
Tigar T A 6: 127,089,204 T124S possibly damaging Het
Tsn A G 1: 118,304,713 V144A probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp943 T A 17: 21,993,075 C381S probably damaging Het
Zfyve19 A T 2: 119,209,114 probably benign Het
Other mutations in Stk31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Stk31 APN 6 49437443 missense probably benign 0.41
IGL02479:Stk31 APN 6 49421688 missense probably damaging 0.99
IGL02490:Stk31 APN 6 49417535 missense probably benign 0.04
IGL03165:Stk31 APN 6 49445264 missense probably damaging 0.98
3-1:Stk31 UTSW 6 49417202 nonsense probably null
R0016:Stk31 UTSW 6 49437377 missense probably damaging 1.00
R0016:Stk31 UTSW 6 49437377 missense probably damaging 1.00
R0039:Stk31 UTSW 6 49442258 missense probably damaging 1.00
R0616:Stk31 UTSW 6 49423485 missense probably damaging 1.00
R0732:Stk31 UTSW 6 49417495 missense probably benign 0.00
R0975:Stk31 UTSW 6 49423409 missense probably damaging 1.00
R1127:Stk31 UTSW 6 49409207 missense probably damaging 1.00
R1705:Stk31 UTSW 6 49423384 missense possibly damaging 0.94
R1711:Stk31 UTSW 6 49469304 missense probably benign 0.10
R1892:Stk31 UTSW 6 49438474 missense probably damaging 1.00
R1942:Stk31 UTSW 6 49439127 missense probably damaging 0.98
R1953:Stk31 UTSW 6 49446478 critical splice donor site probably null
R2149:Stk31 UTSW 6 49439218 missense possibly damaging 0.80
R2281:Stk31 UTSW 6 49417250 missense probably damaging 1.00
R3438:Stk31 UTSW 6 49437521 missense probably benign 0.00
R4681:Stk31 UTSW 6 49437435 missense probably benign 0.37
R5333:Stk31 UTSW 6 49469152 missense probably benign 0.00
R5782:Stk31 UTSW 6 49469136 missense probably benign 0.00
R5820:Stk31 UTSW 6 49417285 missense probably damaging 0.96
R5931:Stk31 UTSW 6 49469302 missense probably benign 0.05
R6012:Stk31 UTSW 6 49469309 missense probably damaging 0.96
R6254:Stk31 UTSW 6 49421697 missense probably benign 0.08
R6281:Stk31 UTSW 6 49469180 missense possibly damaging 0.93
R6294:Stk31 UTSW 6 49417344 missense probably benign 0.18
R6401:Stk31 UTSW 6 49423438 missense probably damaging 1.00
R7289:Stk31 UTSW 6 49438459 missense probably benign 0.05
R7490:Stk31 UTSW 6 49439232 critical splice donor site probably null
R7659:Stk31 UTSW 6 49423406 missense probably benign 0.00
Z1088:Stk31 UTSW 6 49417188 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTTTCCAGGACTTGTCCAAATG -3'
(R):5'- CATGACTCTGAAGTTCCAATCTTG -3'

Sequencing Primer
(F):5'- TCCAAATGGATGAAGATACACATTAC -3'
(R):5'- CAACATAGGAAAACTGCATGTTGC -3'
Posted On2016-10-05