Mutagenetix > Incidental Mutations

Incidental Mutation 'R5492:Frem3'

432123

Institutional Source

Beutler Lab

Gene Symbol

Frem3

Ensembl Gene

ENSMUSG00000042353

Gene Name

Fras1 related extracellular matrix protein 3

Synonyms

LOC333315

MMRRC Submission

043053-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R5492 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80611080-80695356 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80612677 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 533 (D533V)

Ref Sequence

ENSEMBL: ENSMUSP00000038015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039695]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039695
AA Change: D533V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: D533V

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Cadherin_3	369	515	9.5e-31	PFAM
Pfam:Cadherin_3	495	596	9.4e-20	PFAM
Pfam:Cadherin_3	637	786	4.2e-20	PFAM
Pfam:Cadherin_3	788	913	5.5e-23	PFAM
Pfam:Cadherin_3	998	1163	1.8e-20	PFAM
Pfam:Cadherin_3	1129	1254	1.3e-19	PFAM
Pfam:Cadherin_3	1250	1395	9.5e-34	PFAM
Pfam:Cadherin_3	1397	1508	2.7e-21	PFAM
Pfam:Cadherin_3	1493	1617	1.2e-27	PFAM
Pfam:Cadherin_3	1622	1748	4.8e-17	PFAM
Calx_beta	1754	1853	1.45e-7	SMART
Calx_beta	1866	1977	3.35e-12	SMART
Calx_beta	1991	2098	1.61e-5	SMART

Coding Region Coverage

1x: 98.2%
3x: 97.1%
10x: 94.5%
20x: 89.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	T	1: 11,545,207	R135C	probably damaging	Het
Abcd2	A	G	15: 91,188,973	Y328H	probably benign	Het
Abcg4	T	C	9: 44,278,058	T381A	probably benign	Het
Adamts12	A	G	15: 11,336,298	N1490D	probably benign	Het
Aldh18a1	C	T	19: 40,551,290	R747Q	probably damaging	Het
Armc8	G	T	9: 99,527,131	C169*	probably null	Het
Birc6	A	C	17: 74,670,374	N4388T	probably damaging	Het
Bsn	G	A	9: 108,112,515	P2013S	probably damaging	Het
Cdc16	A	G	8: 13,763,915		probably null	Het
Cmtr1	T	A	17: 29,690,342	F408L	probably damaging	Het
Col4a2	C	T	8: 11,438,608	R1104W	possibly damaging	Het
Drg2	A	C	11: 60,461,596	H208P	probably damaging	Het
Gm9930	T	A	10: 9,534,593		noncoding transcript	Het
Haus5	A	G	7: 30,658,955	V305A	possibly damaging	Het
Hint3	C	A	10: 30,618,249	R30L	probably benign	Het
Hltf	T	A	3: 20,098,067		probably null	Het
Hmcn2	T	A	2: 31,420,306	L3304Q	probably benign	Het
Hspa2	A	G	12: 76,404,534	M1V	probably null	Het
Htr5b	T	C	1: 121,527,658	T178A	possibly damaging	Het
Ighv1-11	A	G	12: 114,612,464	S44P	probably damaging	Het
Larp1b	C	T	3: 40,969,899	R104W	probably damaging	Het
Map3k2	A	G	18: 32,228,136	T550A	probably damaging	Het
Map4	T	A	9: 110,052,382	S105T	possibly damaging	Het
Mgam	T	C	6: 40,756,363	C691R	probably damaging	Het
Mms19	A	G	19: 41,955,831	I310T	possibly damaging	Het
Myh2	A	C	11: 67,180,875	K506T	probably benign	Het
Ngdn	T	C	14: 55,023,052	V239A	probably benign	Het
Plin1	G	A	7: 79,725,712	R151*	probably null	Het
Rbpjl	GCC	GC	2: 164,414,410		probably null	Het
Rdh16f2	G	T	10: 127,866,754	E67*	probably null	Het
Slc25a36	A	C	9: 97,100,206	C25W	probably damaging	Het
Stk31	G	A	6: 49,398,243	A49T	probably damaging	Het
Tigar	T	A	6: 127,089,204	T124S	possibly damaging	Het
Tsn	A	G	1: 118,304,713	V144A	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het
Zfp943	T	A	17: 21,993,075	C381S	probably damaging	Het
Zfyve19	A	T	2: 119,209,114		probably benign	Het

Other mutations in Frem3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Frem3	APN	8	80668810	missense	possibly damaging	0.75
IGL01019:Frem3	APN	8	80615134	missense	probably benign	0.02
IGL01470:Frem3	APN	8	80614315	missense	probably damaging	1.00
IGL01609:Frem3	APN	8	80612704	missense	probably benign	0.00
IGL01622:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01623:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01751:Frem3	APN	8	80615743	missense	probably benign	0.33
IGL02037:Frem3	APN	8	80611489	missense	probably benign	0.31
IGL02039:Frem3	APN	8	80612971	missense	probably damaging	1.00
IGL02084:Frem3	APN	8	80612443	missense	possibly damaging	0.95
IGL02124:Frem3	APN	8	80613094	missense	probably damaging	0.99
IGL02140:Frem3	APN	8	80614107	missense	possibly damaging	0.84
IGL02836:Frem3	APN	8	80614381	missense	probably benign
IGL03090:Frem3	APN	8	80618229	missense	probably benign	0.01
IGL03102:Frem3	APN	8	80613032	missense	possibly damaging	0.92
IGL03116:Frem3	APN	8	80612806	missense	possibly damaging	0.84
IGL03165:Frem3	APN	8	80612529	missense	probably benign	0.26
IGL03224:Frem3	APN	8	80613463	missense	probably damaging	1.00
IGL03401:Frem3	APN	8	80614541	missense	probably damaging	1.00
IGL03403:Frem3	APN	8	80611090	missense	probably benign	0.04
FR4340:Frem3	UTSW	8	80615241	small insertion	probably benign
FR4976:Frem3	UTSW	8	80615241	small insertion	probably benign
IGL02991:Frem3	UTSW	8	80668882	missense	probably damaging	1.00
IGL03052:Frem3	UTSW	8	80614530	missense	probably damaging	1.00
R0089:Frem3	UTSW	8	80615878	missense	possibly damaging	0.94
R0647:Frem3	UTSW	8	80615185	missense	probably damaging	1.00
R0690:Frem3	UTSW	8	80613952	missense	possibly damaging	0.84
R0766:Frem3	UTSW	8	80615322	missense	probably benign
R0834:Frem3	UTSW	8	80687008	missense	probably damaging	1.00
R0909:Frem3	UTSW	8	80663406	missense	probably benign	0.45
R1033:Frem3	UTSW	8	80695157	missense	probably benign	0.00
R1144:Frem3	UTSW	8	80611884	missense	probably benign	0.01
R1312:Frem3	UTSW	8	80615322	missense	probably benign
R1330:Frem3	UTSW	8	80668839	missense	probably damaging	0.99
R1355:Frem3	UTSW	8	80690702	missense	probably damaging	1.00
R1390:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R1413:Frem3	UTSW	8	80668801	missense	probably benign
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1503:Frem3	UTSW	8	80687018	missense	probably damaging	0.99
R1538:Frem3	UTSW	8	80612710	missense	probably damaging	1.00
R1538:Frem3	UTSW	8	80613135	missense	probably benign	0.00
R1612:Frem3	UTSW	8	80614861	missense	probably damaging	1.00
R1793:Frem3	UTSW	8	80613112	missense	probably benign	0.03
R1872:Frem3	UTSW	8	80612576	missense	probably damaging	1.00
R1879:Frem3	UTSW	8	80611938	nonsense	probably null
R1886:Frem3	UTSW	8	80613885	missense	probably benign	0.00
R1933:Frem3	UTSW	8	80612890	missense	probably benign	0.00
R2027:Frem3	UTSW	8	80695337	missense	possibly damaging	0.75
R2040:Frem3	UTSW	8	80615826	missense	possibly damaging	0.92
R2050:Frem3	UTSW	8	80614891	missense	probably damaging	1.00
R2079:Frem3	UTSW	8	80615103	missense	probably benign	0.03
R2099:Frem3	UTSW	8	80615859	missense	probably benign	0.06
R2120:Frem3	UTSW	8	80615457	missense	probably benign	0.20
R2842:Frem3	UTSW	8	80669349	splice site	probably null
R2845:Frem3	UTSW	8	80613220	missense	probably damaging	1.00
R3015:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R3442:Frem3	UTSW	8	80613040	missense	probably damaging	1.00
R3724:Frem3	UTSW	8	80615271	missense	probably benign	0.06
R3730:Frem3	UTSW	8	80615916	missense	probably damaging	0.99
R3939:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3940:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3941:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R4089:Frem3	UTSW	8	80615173	missense	probably damaging	1.00
R4282:Frem3	UTSW	8	80614141	missense	probably benign	0.00
R4437:Frem3	UTSW	8	80612607	missense	probably benign	0.30
R4480:Frem3	UTSW	8	80611357	missense	probably benign	0.10
R4575:Frem3	UTSW	8	80616075	missense	probably benign	0.17
R4583:Frem3	UTSW	8	80613514	missense	probably benign	0.03
R4620:Frem3	UTSW	8	80668957	missense	possibly damaging	0.82
R4621:Frem3	UTSW	8	80669191	splice site	probably null
R4644:Frem3	UTSW	8	80613727	missense	probably benign	0.33
R4667:Frem3	UTSW	8	80663420	missense	probably damaging	0.97
R4748:Frem3	UTSW	8	80611459	missense	probably damaging	1.00
R4823:Frem3	UTSW	8	80613958	missense	probably benign	0.25
R4836:Frem3	UTSW	8	80663397	missense	probably damaging	0.99
R4867:Frem3	UTSW	8	80613283	missense	probably damaging	1.00
R4921:Frem3	UTSW	8	80613136	missense	possibly damaging	0.83
R5030:Frem3	UTSW	8	80613247	missense	possibly damaging	0.89
R5035:Frem3	UTSW	8	80615914	missense	probably damaging	0.97
R5172:Frem3	UTSW	8	80612566	missense	probably benign	0.44
R5289:Frem3	UTSW	8	80612319	missense	probably benign	0.00
R5655:Frem3	UTSW	8	80612694	missense	probably benign	0.00
R5685:Frem3	UTSW	8	80695303	missense	probably damaging	1.00
R5723:Frem3	UTSW	8	80613397	missense	probably benign	0.02
R5743:Frem3	UTSW	8	80615778	missense	probably damaging	0.98
R5889:Frem3	UTSW	8	80614288	missense	probably damaging	1.00
R6048:Frem3	UTSW	8	80613433	missense	probably benign	0.03
R6057:Frem3	UTSW	8	80615587	missense	probably damaging	0.99
R6137:Frem3	UTSW	8	80615047	missense	probably benign
R6264:Frem3	UTSW	8	80615203	missense	probably damaging	1.00
R6339:Frem3	UTSW	8	80613015	missense	possibly damaging	0.84
R6418:Frem3	UTSW	8	80611152	missense	probably benign	0.08
R6680:Frem3	UTSW	8	80669320	missense	probably damaging	1.00
R6773:Frem3	UTSW	8	80611815	missense	probably damaging	1.00
R6838:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R6928:Frem3	UTSW	8	80611282	missense	possibly damaging	0.48
R6939:Frem3	UTSW	8	80615145	missense	probably benign	0.23
R6995:Frem3	UTSW	8	80612579	missense	probably damaging	0.98
R7112:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7155:Frem3	UTSW	8	80616039	missense	probably benign	0.01
R7235:Frem3	UTSW	8	80690725	missense	probably benign	0.00
R7282:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7403:Frem3	UTSW	8	80616145	missense	probably damaging	1.00
R7422:Frem3	UTSW	8	80615763	missense	probably benign	0.00
R7485:Frem3	UTSW	8	80613336	missense	probably damaging	1.00
R7516:Frem3	UTSW	8	80612083	missense	probably damaging	0.99
R7858:Frem3	UTSW	8	80611721	nonsense	probably null
R7976:Frem3	UTSW	8	80611602	nonsense	probably null
R8171:Frem3	UTSW	8	80615240	missense	probably damaging	1.00
R8185:Frem3	UTSW	8	80612304	nonsense	probably null
R8306:Frem3	UTSW	8	80612211	missense	possibly damaging	0.95
R8518:Frem3	UTSW	8	80612595	missense	probably damaging	1.00
RF030:Frem3	UTSW	8	80615238	small insertion	probably benign
RF034:Frem3	UTSW	8	80615238	small insertion	probably benign
RF042:Frem3	UTSW	8	80615238	small insertion	probably benign
X0024:Frem3	UTSW	8	80613081	missense	possibly damaging	0.76
X0027:Frem3	UTSW	8	80612388	nonsense	probably null
Z1088:Frem3	UTSW	8	80615426	missense	probably benign	0.04
Z1176:Frem3	UTSW	8	80611503	missense	probably damaging	0.99
Z1176:Frem3	UTSW	8	80615431	missense	probably benign	0.03
Z1177:Frem3	UTSW	8	80616129	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GTCAGAGGTTTGCAACACGG -3'
(R):5'- TGGCTTGAGCTGTAGGAAC -3'

Sequencing Primer
(F):5'- TTTGCAACACGGGCAGCTG -3'
(R):5'- AACCAGGGGCCAGATCTTCATG -3'

Posted On

2016-10-05