Incidental Mutation 'R5493:Rbpjl'
ID432156
Institutional Source Beutler Lab
Gene Symbol Rbpjl
Ensembl Gene ENSMUSG00000017007
Gene Namerecombination signal binding protein for immunoglobulin kappa J region-like
SynonymsRBP-J kappa-like, Rbpsuhl, RBP-L
MMRRC Submission 043054-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5493 (G1)
Quality Score217
Status Validated
Chromosome2
Chromosomal Location164403141-164415448 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCC to GC at 164414410 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017151]
Predicted Effect probably null
Transcript: ENSMUST00000017151
SMART Domains Protein: ENSMUSP00000017151
Gene: ENSMUSG00000017007

DomainStartEndE-ValueType
LAG1_DNAbind 66 204 4.58e-78 SMART
BTD 205 357 1.23e-83 SMART
SCOP:d1a02n1 383 475 3e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137427
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of hairless protein family. A similar protein in mouse is a transcription factor that binds to DNA sequences almost identical to that bound by the Notch receptor signaling pathway transcription factor recombining binding protein J. The mouse protein has been shown to activate transcription in concert with Epstein-Barr virus nuclear antigen-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene do not display any obvious phenotype abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,243 S236P possibly damaging Het
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Agpat3 A G 10: 78,284,235 V155A possibly damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Aloxe3 A T 11: 69,128,617 R119* probably null Het
Asap1 A G 15: 64,130,151 V460A possibly damaging Het
Bicral C A 17: 46,801,694 R860L possibly damaging Het
Cd180 T A 13: 102,706,141 I565N probably benign Het
Cdk13 T C 13: 17,803,562 probably benign Het
Cdkn2d T C 9: 21,289,007 D156G probably benign Het
Clrn1 A G 3: 58,846,416 S175P probably damaging Het
Coro7 A G 16: 4,632,487 L535S probably damaging Het
Cse1l A G 2: 166,941,190 probably benign Het
Cyp2a12 T C 7: 27,029,125 L7P unknown Het
D130043K22Rik A G 13: 24,863,603 Y377C probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Duox2 T C 2: 122,281,496 Q1341R probably damaging Het
Eif2b3 A G 4: 117,086,722 D447G possibly damaging Het
Fbxw25 T C 9: 109,652,916 Y234C probably benign Het
Gcnt2 A G 13: 40,953,600 N315S possibly damaging Het
Gm20730 A T 6: 43,081,812 V22E possibly damaging Het
Gm4847 T A 1: 166,630,321 I488F probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gmds A T 13: 31,940,505 M290K probably benign Het
Gtf3c1 T C 7: 125,670,544 N699S probably damaging Het
Hk3 A G 13: 55,011,171 V479A probably damaging Het
Ifnlr1 G A 4: 135,705,566 V438M probably benign Het
Il12rb1 C A 8: 70,809,839 P26T probably benign Het
Il4i1 G T 7: 44,840,053 R414L possibly damaging Het
Ipo4 T C 14: 55,630,870 N490S probably benign Het
Kcnmb2 A G 3: 32,198,142 E164G probably damaging Het
Kcns1 G A 2: 164,167,979 L287F probably benign Het
Kdm1a ACC AC 4: 136,557,421 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Knl1 T A 2: 119,068,730 I304K probably damaging Het
Ksr2 G T 5: 117,708,110 V681F probably damaging Het
Lypd2 T C 15: 74,734,278 T4A probably benign Het
Man1a A G 10: 54,074,480 V182A probably benign Het
Olfr1364 A T 13: 21,573,872 C195S probably damaging Het
Olfr504 T C 7: 108,565,567 D76G probably benign Het
Olfr533 A T 7: 140,466,807 D202V probably damaging Het
Olfr561 A T 7: 102,775,108 R195W probably benign Het
Olfr70 A G 4: 43,696,225 F316S possibly damaging Het
Pcdha2 C A 18: 36,939,509 F64L probably damaging Het
Pgap3 G C 11: 98,390,714 F168L possibly damaging Het
Pip5k1b T C 19: 24,439,075 N16S probably benign Het
Ppip5k1 T A 2: 121,336,772 H41L probably damaging Het
Ppp1r9a A G 6: 5,159,702 R1080G probably damaging Het
Qrich2 A C 11: 116,445,948 probably null Het
Rbl2 C T 8: 91,115,819 P1034L probably damaging Het
Rin2 A G 2: 145,860,709 S442G probably damaging Het
Rtca C T 3: 116,499,631 R71Q probably benign Het
Serpind1 A T 16: 17,340,038 N366I probably damaging Het
Shox2 C G 3: 66,981,463 G32R probably damaging Het
Sp3 T A 2: 72,938,122 N766Y probably damaging Het
Spag7 T A 11: 70,669,233 S17C probably null Het
Stk25 A T 1: 93,635,309 F7I probably benign Het
Tbx15 G A 3: 99,352,564 G584S probably benign Het
Tenm2 T C 11: 36,864,676 D165G probably benign Het
Tox2 C A 2: 163,204,729 S42* probably null Het
Vmn1r39 A G 6: 66,804,770 V188A probably damaging Het
Zbtb5 A T 4: 44,993,941 M481K probably benign Het
Zfp26 T C 9: 20,444,319 T56A possibly damaging Het
Zfp459 C A 13: 67,408,379 C195F probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp764 A G 7: 127,404,933 I342T probably benign Het
Zfp942 T C 17: 21,933,004 N7D probably null Het
Other mutations in Rbpjl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Rbpjl APN 2 164407785 missense possibly damaging 0.74
IGL02429:Rbpjl APN 2 164413895 missense possibly damaging 0.80
R2155:Rbpjl UTSW 2 164414423 missense possibly damaging 0.80
R2244:Rbpjl UTSW 2 164403217 intron probably benign
R2344:Rbpjl UTSW 2 164414392 missense probably damaging 0.99
R4721:Rbpjl UTSW 2 164404527 missense probably benign 0.08
R5023:Rbpjl UTSW 2 164410289 missense probably damaging 1.00
R5492:Rbpjl UTSW 2 164414410 frame shift probably null
R5494:Rbpjl UTSW 2 164414410 frame shift probably null
R5556:Rbpjl UTSW 2 164408062 missense probably benign 0.01
R5796:Rbpjl UTSW 2 164410248 splice site probably benign
R6164:Rbpjl UTSW 2 164410879 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACGGAGAAAATTTCCACG -3'
(R):5'- TGAACTCGTGGTGGATGCTC -3'

Sequencing Primer
(F):5'- GAGAAAATTTCCACGCTGGGCTC -3'
(R):5'- CTCTCCAGGAGCGTGTC -3'
Posted On2016-10-05