Mutagenetix > Incidental Mutation

Incidental Mutation 'R5493:Cse1l'

432157

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

MMRRC Submission

043054-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5493 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 166941190 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]

AlphaFold

Q9ERK4

Predicted Effect

probably benign
Transcript: ENSMUST00000002790

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145819

Predicted Effect

probably benign
Transcript: ENSMUST00000163437

SMART Domains

Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
Pfam:Cse1	1	237	7.9e-105	PFAM
Pfam:CAS_CSE1	225	649	2.3e-195	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163917

Predicted Effect

probably benign
Transcript: ENSMUST00000164974

SMART Domains

Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
Pfam:CAS_CSE1	24	72	5.4e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166871

Predicted Effect

probably benign
Transcript: ENSMUST00000168599

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169290

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172037

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.1%
20x: 90.4%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510009E07Rik	A	G	16: 21,653,243	S236P	possibly damaging	Het
A830018L16Rik	C	T	1: 11,545,207	R135C	probably damaging	Het
Agpat3	A	G	10: 78,284,235	V155A	possibly damaging	Het
Aldh18a1	C	T	19: 40,551,290	R747Q	probably damaging	Het
Aloxe3	A	T	11: 69,128,617	R119*	probably null	Het
Asap1	A	G	15: 64,130,151	V460A	possibly damaging	Het
Bicral	C	A	17: 46,801,694	R860L	possibly damaging	Het
Cd180	T	A	13: 102,706,141	I565N	probably benign	Het
Cdk13	T	C	13: 17,803,562		probably benign	Het
Cdkn2d	T	C	9: 21,289,007	D156G	probably benign	Het
Clrn1	A	G	3: 58,846,416	S175P	probably damaging	Het
Coro7	A	G	16: 4,632,487	L535S	probably damaging	Het
Cyp2a12	T	C	7: 27,029,125	L7P	unknown	Het
D130043K22Rik	A	G	13: 24,863,603	Y377C	probably damaging	Het
Dctn1	G	T	6: 83,182,564	R8L	possibly damaging	Het
Duox2	T	C	2: 122,281,496	Q1341R	probably damaging	Het
Eif2b3	A	G	4: 117,086,722	D447G	possibly damaging	Het
Fbxw25	T	C	9: 109,652,916	Y234C	probably benign	Het
Gcnt2	A	G	13: 40,953,600	N315S	possibly damaging	Het
Gm20730	A	T	6: 43,081,812	V22E	possibly damaging	Het
Gm4847	T	A	1: 166,630,321	I488F	probably damaging	Het
Gm8994	C	G	6: 136,329,557	R339G	probably damaging	Het
Gmds	A	T	13: 31,940,505	M290K	probably benign	Het
Gtf3c1	T	C	7: 125,670,544	N699S	probably damaging	Het
Hk3	A	G	13: 55,011,171	V479A	probably damaging	Het
Ifnlr1	G	A	4: 135,705,566	V438M	probably benign	Het
Il12rb1	C	A	8: 70,809,839	P26T	probably benign	Het
Il4i1	G	T	7: 44,840,053	R414L	possibly damaging	Het
Ipo4	T	C	14: 55,630,870	N490S	probably benign	Het
Kcnmb2	A	G	3: 32,198,142	E164G	probably damaging	Het
Kcns1	G	A	2: 164,167,979	L287F	probably benign	Het
Kdm1a	ACC	AC	4: 136,557,421		probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Knl1	T	A	2: 119,068,730	I304K	probably damaging	Het
Ksr2	G	T	5: 117,708,110	V681F	probably damaging	Het
Lypd2	T	C	15: 74,734,278	T4A	probably benign	Het
Man1a	A	G	10: 54,074,480	V182A	probably benign	Het
Olfr1364	A	T	13: 21,573,872	C195S	probably damaging	Het
Olfr504	T	C	7: 108,565,567	D76G	probably benign	Het
Olfr533	A	T	7: 140,466,807	D202V	probably damaging	Het
Olfr561	A	T	7: 102,775,108	R195W	probably benign	Het
Olfr70	A	G	4: 43,696,225	F316S	possibly damaging	Het
Pcdha2	C	A	18: 36,939,509	F64L	probably damaging	Het
Pgap3	G	C	11: 98,390,714	F168L	possibly damaging	Het
Pip5k1b	T	C	19: 24,439,075	N16S	probably benign	Het
Ppip5k1	T	A	2: 121,336,772	H41L	probably damaging	Het
Ppp1r9a	A	G	6: 5,159,702	R1080G	probably damaging	Het
Qrich2	A	C	11: 116,445,948		probably null	Het
Rbl2	C	T	8: 91,115,819	P1034L	probably damaging	Het
Rbpjl	GCC	GC	2: 164,414,410		probably null	Het
Rin2	A	G	2: 145,860,709	S442G	probably damaging	Het
Rtca	C	T	3: 116,499,631	R71Q	probably benign	Het
Serpind1	A	T	16: 17,340,038	N366I	probably damaging	Het
Shox2	C	G	3: 66,981,463	G32R	probably damaging	Het
Sp3	T	A	2: 72,938,122	N766Y	probably damaging	Het
Spag7	T	A	11: 70,669,233	S17C	probably null	Het
Stk25	A	T	1: 93,635,309	F7I	probably benign	Het
Tbx15	G	A	3: 99,352,564	G584S	probably benign	Het
Tenm2	T	C	11: 36,864,676	D165G	probably benign	Het
Tox2	C	A	2: 163,204,729	S42*	probably null	Het
Vmn1r39	A	G	6: 66,804,770	V188A	probably damaging	Het
Zbtb5	A	T	4: 44,993,941	M481K	probably benign	Het
Zfp26	T	C	9: 20,444,319	T56A	possibly damaging	Het
Zfp459	C	A	13: 67,408,379	C195F	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het
Zfp764	A	G	7: 127,404,933	I342T	probably benign	Het
Zfp942	T	C	17: 21,933,004	N7D	probably null	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
ANU23:Cse1l	UTSW	2	166927508	nonsense	probably null
PIT4585001:Cse1l	UTSW	2	166941474	missense	probably damaging	1.00
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R2398:Cse1l	UTSW	2	166928997	missense	probably damaging	1.00
R4110:Cse1l	UTSW	2	166942050	missense	probably benign	0.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5475:Cse1l	UTSW	2	166941254	missense	probably damaging	1.00
R5782:Cse1l	UTSW	2	166929001	missense	probably damaging	1.00
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7683:Cse1l	UTSW	2	166922788	missense	probably benign
R7871:Cse1l	UTSW	2	166935671	splice site	probably null
R8001:Cse1l	UTSW	2	166939913	missense	probably damaging	1.00
R8057:Cse1l	UTSW	2	166939925	missense	probably damaging	1.00
R8175:Cse1l	UTSW	2	166943208	critical splice donor site	probably null
R8347:Cse1l	UTSW	2	166927585	missense	possibly damaging	0.95
R8386:Cse1l	UTSW	2	166919684	missense	probably benign	0.00
R8479:Cse1l	UTSW	2	166921973	missense	possibly damaging	0.95
R8973:Cse1l	UTSW	2	166943080	missense	probably damaging	1.00
R9206:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9208:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9522:Cse1l	UTSW	2	166934753	missense	probably benign
R9599:Cse1l	UTSW	2	166941466	missense	probably benign
R9600:Cse1l	UTSW	2	166915199	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTTTACAGTCCAGAAATAACTGC -3'
(R):5'- TCAGCCCCTTATGAACACG -3'

Sequencing Primer
(F):5'- CAGTCCAGAAATAACTGCTAGAAAAG -3'
(R):5'- CACGTAACAATCTTTGCATCAGTG -3'

Posted On

2016-10-05