Incidental Mutation 'R0478:Sept3'
ID43216
Institutional Source Beutler Lab
Gene Symbol Sept3
Ensembl Gene ENSMUSG00000022456
Gene Nameseptin 3
SynonymsB530002E20Rik, Sep3, 3110018K01Rik
MMRRC Submission 038678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R0478 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82274893-82294574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82290806 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 172 (L172P)
Ref Sequence ENSEMBL: ENSMUSP00000155353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023095] [ENSMUST00000116423] [ENSMUST00000230365] [ENSMUST00000230418] [ENSMUST00000230507]
Predicted Effect probably damaging
Transcript: ENSMUST00000023095
AA Change: L316P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023095
Gene: ENSMUSG00000022456
AA Change: L316P

DomainStartEndE-ValueType
Pfam:DUF258 27 143 9.1e-9 PFAM
Pfam:Septin 45 322 8.9e-117 PFAM
Pfam:AIG1 49 145 2.6e-7 PFAM
Pfam:MMR_HSR1 50 220 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116423
AA Change: L316P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112124
Gene: ENSMUSG00000022456
AA Change: L316P

DomainStartEndE-ValueType
Pfam:Septin 45 322 1.2e-116 PFAM
Pfam:MMR_HSR1 50 195 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229067
Predicted Effect probably damaging
Transcript: ENSMUST00000230365
AA Change: L316P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000230418
Predicted Effect probably damaging
Transcript: ENSMUST00000230507
AA Change: L172P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230799
Meta Mutation Damage Score 0.9733 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the septin family of GTPases. Members of this family are required for cytokinesis. Expression is upregulated by retinoic acid in a human teratocarcinoma cell line. The specific function of this gene has not been determined. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,562,589 noncoding transcript Het
4930556J24Rik T G 11: 3,976,259 probably benign Het
Acnat1 T G 4: 49,450,901 D70A probably damaging Het
Adnp2 A G 18: 80,129,334 V620A probably benign Het
Aldoart1 T A 4: 72,852,343 H21L probably benign Het
Birc3 A G 9: 7,860,347 V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 probably benign Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Clmn A G 12: 104,785,491 M235T probably damaging Het
Dmbt1 A G 7: 131,041,187 E245G possibly damaging Het
Epgn G T 5: 91,031,128 V36L probably benign Het
Ets2 C A 16: 95,716,262 P346Q probably damaging Het
Fam222b T C 11: 78,153,856 L81P probably damaging Het
Fancf A C 7: 51,861,692 L188R probably damaging Het
Fibin T C 2: 110,362,734 D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 probably null Het
Gbp4 T A 5: 105,119,433 Q540L probably benign Het
Greb1l T A 18: 10,509,281 L531Q probably damaging Het
Il5ra A G 6: 106,738,462 V137A probably benign Het
Kif26a G A 12: 112,175,789 A826T probably damaging Het
Kiz T C 2: 146,942,158 V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 G15D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lbp T C 2: 158,317,528 probably benign Het
Mmp25 T C 17: 23,632,782 T318A probably benign Het
Mrpl50 A G 4: 49,514,513 C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 probably null Het
Noc3l A G 19: 38,810,006 probably null Het
Olfr1126 T A 2: 87,458,026 V287E probably damaging Het
Olfr1375 T C 11: 51,048,712 S202P probably benign Het
Pgm5 A T 19: 24,834,869 S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 S350T probably damaging Het
Ptk2b G T 14: 66,213,372 N48K probably damaging Het
Sirt3 A T 7: 140,878,114 C41S probably benign Het
Sphkap C T 1: 83,278,711 R152H probably damaging Het
St3gal1 T C 15: 67,113,730 Y25C probably damaging Het
Tbc1d31 T C 15: 57,932,536 F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 D43E probably benign Het
Tgm1 G A 14: 55,700,334 Q773* probably null Het
Tmc3 A T 7: 83,622,152 R837S possibly damaging Het
Unc13a A G 8: 71,651,148 V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 V268E probably damaging Het
Zan C T 5: 137,400,526 probably benign Het
Zfp760 G T 17: 21,722,014 E57* probably null Het
Other mutations in Sept3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Sept3 APN 15 82279613 unclassified probably benign
IGL01979:Sept3 APN 15 82284392 missense probably damaging 0.99
IGL03118:Sept3 APN 15 82284514 splice site probably null
R0556:Sept3 UTSW 15 82283765 unclassified probably benign
R3804:Sept3 UTSW 15 82286429 splice site probably benign
R3876:Sept3 UTSW 15 82285801 missense probably damaging 1.00
R4589:Sept3 UTSW 15 82285891 missense probably damaging 0.99
R4744:Sept3 UTSW 15 82290457 critical splice donor site probably null
R5954:Sept3 UTSW 15 82290427 missense probably damaging 1.00
R6434:Sept3 UTSW 15 82279603 missense possibly damaging 0.92
R7257:Sept3 UTSW 15 82289213 missense probably damaging 0.99
R7475:Sept3 UTSW 15 82286456 missense probably benign 0.00
R7641:Sept3 UTSW 15 82290782 missense probably damaging 1.00
R7754:Sept3 UTSW 15 82290773 missense probably benign 0.03
R7895:Sept3 UTSW 15 82285819 missense probably benign 0.00
R7978:Sept3 UTSW 15 82285819 missense probably benign 0.00
RF020:Sept3 UTSW 15 82284461 missense probably damaging 1.00
X0065:Sept3 UTSW 15 82279504 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTCTCTATCCCAGTGCATCTCAG -3'
(R):5'- GGGCAATGAAAATACCTCACCCCTG -3'

Sequencing Primer
(F):5'- CATCTCAGAGGGGTTGTAAAATTGAC -3'
(R):5'- actctccatcacacacacatac -3'
Posted On2013-05-23