Incidental Mutation 'R5493:Tbx15'
ID 432161
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 043054-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R5493 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 99259880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 584 (G584S)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect probably benign
Transcript: ENSMUST00000029462
AA Change: G584S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: G584S

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Meta Mutation Damage Score 0.0686 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,471,993 (GRCm39) S236P possibly damaging Het
A830018L16Rik C T 1: 11,615,431 (GRCm39) R135C probably damaging Het
Agpat3 A G 10: 78,120,069 (GRCm39) V155A possibly damaging Het
Aldh18a1 C T 19: 40,539,734 (GRCm39) R747Q probably damaging Het
Aloxe3 A T 11: 69,019,443 (GRCm39) R119* probably null Het
Asap1 A G 15: 64,002,000 (GRCm39) V460A possibly damaging Het
Bicral C A 17: 47,112,620 (GRCm39) R860L possibly damaging Het
Cd180 T A 13: 102,842,649 (GRCm39) I565N probably benign Het
Cdk13 T C 13: 17,978,147 (GRCm39) probably benign Het
Cdkn2d T C 9: 21,200,303 (GRCm39) D156G probably benign Het
Clrn1 A G 3: 58,753,837 (GRCm39) S175P probably damaging Het
Coro7 A G 16: 4,450,351 (GRCm39) L535S probably damaging Het
Cse1l A G 2: 166,783,110 (GRCm39) probably benign Het
Cyp2a12 T C 7: 26,728,550 (GRCm39) L7P unknown Het
D130043K22Rik A G 13: 25,047,586 (GRCm39) Y377C probably damaging Het
Dctn1 G T 6: 83,159,546 (GRCm39) R8L possibly damaging Het
Duox2 T C 2: 122,111,977 (GRCm39) Q1341R probably damaging Het
Eif2b3 A G 4: 116,943,919 (GRCm39) D447G possibly damaging Het
Eif4a3l1 C G 6: 136,306,555 (GRCm39) R339G probably damaging Het
Fbxw25 T C 9: 109,481,984 (GRCm39) Y234C probably benign Het
Gcnt2 A G 13: 41,107,076 (GRCm39) N315S possibly damaging Het
Gm20730 A T 6: 43,058,746 (GRCm39) V22E possibly damaging Het
Gm4847 T A 1: 166,457,890 (GRCm39) I488F probably damaging Het
Gmds A T 13: 32,124,488 (GRCm39) M290K probably benign Het
Gtf3c1 T C 7: 125,269,716 (GRCm39) N699S probably damaging Het
Hk3 A G 13: 55,158,984 (GRCm39) V479A probably damaging Het
Ifnlr1 G A 4: 135,432,877 (GRCm39) V438M probably benign Het
Il12rb1 C A 8: 71,262,483 (GRCm39) P26T probably benign Het
Il4i1 G T 7: 44,489,477 (GRCm39) R414L possibly damaging Het
Ipo4 T C 14: 55,868,327 (GRCm39) N490S probably benign Het
Kcnmb2 A G 3: 32,252,291 (GRCm39) E164G probably damaging Het
Kcns1 G A 2: 164,009,899 (GRCm39) L287F probably benign Het
Kdm1a ACC AC 4: 136,284,732 (GRCm39) probably null Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Knl1 T A 2: 118,899,211 (GRCm39) I304K probably damaging Het
Ksr2 G T 5: 117,846,175 (GRCm39) V681F probably damaging Het
Lypd2 T C 15: 74,606,127 (GRCm39) T4A probably benign Het
Man1a A G 10: 53,950,576 (GRCm39) V182A probably benign Het
Or12j4 A T 7: 140,046,720 (GRCm39) D202V probably damaging Het
Or13e8 A G 4: 43,696,225 (GRCm39) F316S possibly damaging Het
Or2w2 A T 13: 21,758,042 (GRCm39) C195S probably damaging Het
Or51f5 A T 7: 102,424,315 (GRCm39) R195W probably benign Het
Or56b1b T C 7: 108,164,774 (GRCm39) D76G probably benign Het
Pcdha2 C A 18: 37,072,562 (GRCm39) F64L probably damaging Het
Pgap3 G C 11: 98,281,540 (GRCm39) F168L possibly damaging Het
Pip5k1b T C 19: 24,416,439 (GRCm39) N16S probably benign Het
Ppip5k1 T A 2: 121,167,253 (GRCm39) H41L probably damaging Het
Ppp1r9a A G 6: 5,159,702 (GRCm39) R1080G probably damaging Het
Qrich2 A C 11: 116,336,774 (GRCm39) probably null Het
Rbl2 C T 8: 91,842,447 (GRCm39) P1034L probably damaging Het
Rbpjl GCC GC 2: 164,256,330 (GRCm39) probably null Het
Rin2 A G 2: 145,702,629 (GRCm39) S442G probably damaging Het
Rtca C T 3: 116,293,280 (GRCm39) R71Q probably benign Het
Serpind1 A T 16: 17,157,902 (GRCm39) N366I probably damaging Het
Shox2 C G 3: 66,888,796 (GRCm39) G32R probably damaging Het
Sp3 T A 2: 72,768,466 (GRCm39) N766Y probably damaging Het
Spag7 T A 11: 70,560,059 (GRCm39) S17C probably null Het
Stk25 A T 1: 93,563,031 (GRCm39) F7I probably benign Het
Tenm2 T C 11: 36,755,503 (GRCm39) D165G probably benign Het
Tox2 C A 2: 163,046,649 (GRCm39) S42* probably null Het
Vmn1r39 A G 6: 66,781,754 (GRCm39) V188A probably damaging Het
Zbtb5 A T 4: 44,993,941 (GRCm39) M481K probably benign Het
Zfp26 T C 9: 20,355,615 (GRCm39) T56A possibly damaging Het
Zfp459 C A 13: 67,556,498 (GRCm39) C195F probably damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Zfp764 A G 7: 127,004,105 (GRCm39) I342T probably benign Het
Zfp942 T C 17: 22,151,985 (GRCm39) N7D probably null Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCAGAGCTCCTATAATGCC -3'
(R):5'- ACTCCAAGGATCCTTCAGCG -3'

Sequencing Primer
(F):5'- AGCAGAGCTCCTATAATGCCTTCTC -3'
(R):5'- CAAGGATCCTTCAGCGGTATC -3'
Posted On 2016-10-05