Mutagenetix > Incidental Mutation

Incidental Mutation 'R5493:Tbx15'

432161

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

043054-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.935) question?

Stock #

R5493 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 99352564 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 584 (G584S)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

probably benign
Transcript: ENSMUST00000029462
AA Change: G584S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: G584S

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Meta Mutation Damage Score

0.0686

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.1%
20x: 90.4%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510009E07Rik	A	G	16: 21,653,243	S236P	possibly damaging	Het
A830018L16Rik	C	T	1: 11,545,207	R135C	probably damaging	Het
Agpat3	A	G	10: 78,284,235	V155A	possibly damaging	Het
Aldh18a1	C	T	19: 40,551,290	R747Q	probably damaging	Het
Aloxe3	A	T	11: 69,128,617	R119*	probably null	Het
Asap1	A	G	15: 64,130,151	V460A	possibly damaging	Het
Bicral	C	A	17: 46,801,694	R860L	possibly damaging	Het
Cd180	T	A	13: 102,706,141	I565N	probably benign	Het
Cdk13	T	C	13: 17,803,562		probably benign	Het
Cdkn2d	T	C	9: 21,289,007	D156G	probably benign	Het
Clrn1	A	G	3: 58,846,416	S175P	probably damaging	Het
Coro7	A	G	16: 4,632,487	L535S	probably damaging	Het
Cse1l	A	G	2: 166,941,190		probably benign	Het
Cyp2a12	T	C	7: 27,029,125	L7P	unknown	Het
D130043K22Rik	A	G	13: 24,863,603	Y377C	probably damaging	Het
Dctn1	G	T	6: 83,182,564	R8L	possibly damaging	Het
Duox2	T	C	2: 122,281,496	Q1341R	probably damaging	Het
Eif2b3	A	G	4: 117,086,722	D447G	possibly damaging	Het
Fbxw25	T	C	9: 109,652,916	Y234C	probably benign	Het
Gcnt2	A	G	13: 40,953,600	N315S	possibly damaging	Het
Gm20730	A	T	6: 43,081,812	V22E	possibly damaging	Het
Gm4847	T	A	1: 166,630,321	I488F	probably damaging	Het
Gm8994	C	G	6: 136,329,557	R339G	probably damaging	Het
Gmds	A	T	13: 31,940,505	M290K	probably benign	Het
Gtf3c1	T	C	7: 125,670,544	N699S	probably damaging	Het
Hk3	A	G	13: 55,011,171	V479A	probably damaging	Het
Ifnlr1	G	A	4: 135,705,566	V438M	probably benign	Het
Il12rb1	C	A	8: 70,809,839	P26T	probably benign	Het
Il4i1	G	T	7: 44,840,053	R414L	possibly damaging	Het
Ipo4	T	C	14: 55,630,870	N490S	probably benign	Het
Kcnmb2	A	G	3: 32,198,142	E164G	probably damaging	Het
Kcns1	G	A	2: 164,167,979	L287F	probably benign	Het
Kdm1a	ACC	AC	4: 136,557,421		probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Knl1	T	A	2: 119,068,730	I304K	probably damaging	Het
Ksr2	G	T	5: 117,708,110	V681F	probably damaging	Het
Lypd2	T	C	15: 74,734,278	T4A	probably benign	Het
Man1a	A	G	10: 54,074,480	V182A	probably benign	Het
Olfr1364	A	T	13: 21,573,872	C195S	probably damaging	Het
Olfr504	T	C	7: 108,565,567	D76G	probably benign	Het
Olfr533	A	T	7: 140,466,807	D202V	probably damaging	Het
Olfr561	A	T	7: 102,775,108	R195W	probably benign	Het
Olfr70	A	G	4: 43,696,225	F316S	possibly damaging	Het
Pcdha2	C	A	18: 36,939,509	F64L	probably damaging	Het
Pgap3	G	C	11: 98,390,714	F168L	possibly damaging	Het
Pip5k1b	T	C	19: 24,439,075	N16S	probably benign	Het
Ppip5k1	T	A	2: 121,336,772	H41L	probably damaging	Het
Ppp1r9a	A	G	6: 5,159,702	R1080G	probably damaging	Het
Qrich2	A	C	11: 116,445,948		probably null	Het
Rbl2	C	T	8: 91,115,819	P1034L	probably damaging	Het
Rbpjl	GCC	GC	2: 164,414,410		probably null	Het
Rin2	A	G	2: 145,860,709	S442G	probably damaging	Het
Rtca	C	T	3: 116,499,631	R71Q	probably benign	Het
Serpind1	A	T	16: 17,340,038	N366I	probably damaging	Het
Shox2	C	G	3: 66,981,463	G32R	probably damaging	Het
Sp3	T	A	2: 72,938,122	N766Y	probably damaging	Het
Spag7	T	A	11: 70,669,233	S17C	probably null	Het
Stk25	A	T	1: 93,635,309	F7I	probably benign	Het
Tenm2	T	C	11: 36,864,676	D165G	probably benign	Het
Tox2	C	A	2: 163,204,729	S42*	probably null	Het
Vmn1r39	A	G	6: 66,804,770	V188A	probably damaging	Het
Zbtb5	A	T	4: 44,993,941	M481K	probably benign	Het
Zfp26	T	C	9: 20,444,319	T56A	possibly damaging	Het
Zfp459	C	A	13: 67,408,379	C195F	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het
Zfp764	A	G	7: 127,404,933	I342T	probably benign	Het
Zfp942	T	C	17: 21,933,004	N7D	probably null	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGCAGAGCTCCTATAATGCC -3'
(R):5'- ACTCCAAGGATCCTTCAGCG -3'

Sequencing Primer
(F):5'- AGCAGAGCTCCTATAATGCCTTCTC -3'
(R):5'- CAAGGATCCTTCAGCGGTATC -3'

Posted On

2016-10-05