Incidental Mutation 'R0478:Kmt2d'
ID 43217
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Name lysine (K)-specific methyltransferase 2D
Synonyms Mll2, C430014K11Rik, Mll4
MMRRC Submission 038678-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0478 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 98831669-98871204 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 98853581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486] [ENSMUST00000184363]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023741
AA Change: A2077V
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: A2077V

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178486
AA Change: A2077V
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: A2077V

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184363
SMART Domains Protein: ENSMUSP00000139020
Gene: ENSMUSG00000048154

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229651
Meta Mutation Damage Score 0.1009 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,562,589 (GRCm38) noncoding transcript Het
4930556J24Rik T G 11: 3,976,259 (GRCm38) probably benign Het
Acnat1 T G 4: 49,450,901 (GRCm38) D70A probably damaging Het
Adnp2 A G 18: 80,129,334 (GRCm38) V620A probably benign Het
Aldoart1 T A 4: 72,852,343 (GRCm38) H21L probably benign Het
Birc3 A G 9: 7,860,347 (GRCm38) V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 (GRCm38) probably benign Het
Camta1 C A 4: 151,075,140 (GRCm38) R1614L probably damaging Het
Clmn A G 12: 104,785,491 (GRCm38) M235T probably damaging Het
Dmbt1 A G 7: 131,041,187 (GRCm38) E245G possibly damaging Het
Epgn G T 5: 91,031,128 (GRCm38) V36L probably benign Het
Ets2 C A 16: 95,716,262 (GRCm38) P346Q probably damaging Het
Fam222b T C 11: 78,153,856 (GRCm38) L81P probably damaging Het
Fancf A C 7: 51,861,692 (GRCm38) L188R probably damaging Het
Fibin T C 2: 110,362,734 (GRCm38) D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 (GRCm38) probably null Het
Gbp4 T A 5: 105,119,433 (GRCm38) Q540L probably benign Het
Greb1l T A 18: 10,509,281 (GRCm38) L531Q probably damaging Het
Il5ra A G 6: 106,738,462 (GRCm38) V137A probably benign Het
Kif26a G A 12: 112,175,789 (GRCm38) A826T probably damaging Het
Kiz T C 2: 146,942,158 (GRCm38) V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 (GRCm38) G15D probably damaging Het
Lbp T C 2: 158,317,528 (GRCm38) probably benign Het
Mmp25 T C 17: 23,632,782 (GRCm38) T318A probably benign Het
Mrpl50 A G 4: 49,514,513 (GRCm38) C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 (GRCm38) E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 (GRCm38) probably null Het
Noc3l A G 19: 38,810,006 (GRCm38) probably null Het
Olfr1126 T A 2: 87,458,026 (GRCm38) V287E probably damaging Het
Olfr1375 T C 11: 51,048,712 (GRCm38) S202P probably benign Het
Pgm5 A T 19: 24,834,869 (GRCm38) S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 (GRCm38) G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 (GRCm38) S350T probably damaging Het
Ptk2b G T 14: 66,213,372 (GRCm38) N48K probably damaging Het
Sept3 T C 15: 82,290,806 (GRCm38) L172P probably damaging Het
Sirt3 A T 7: 140,878,114 (GRCm38) C41S Het
Sphkap C T 1: 83,278,711 (GRCm38) R152H probably damaging Het
St3gal1 T C 15: 67,113,730 (GRCm38) Y25C probably damaging Het
Tbc1d31 T C 15: 57,932,536 (GRCm38) F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 (GRCm38) D43E probably benign Het
Tgm1 G A 14: 55,700,334 (GRCm38) Q773* probably null Het
Tmc3 A T 7: 83,622,152 (GRCm38) R837S possibly damaging Het
Unc13a A G 8: 71,651,148 (GRCm38) V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 (GRCm38) V268E probably damaging Het
Zan C T 5: 137,400,526 (GRCm38) probably benign Het
Zfp760 G T 17: 21,722,014 (GRCm38) E57* probably null Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98,862,333 (GRCm38) missense unknown
IGL00927:Kmt2d APN 15 98,845,009 (GRCm38) unclassified probably benign
IGL01123:Kmt2d APN 15 98,837,148 (GRCm38) missense unknown
IGL01288:Kmt2d APN 15 98,865,044 (GRCm38) missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98,860,657 (GRCm38) unclassified probably benign
IGL01575:Kmt2d APN 15 98,846,855 (GRCm38) utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98,856,369 (GRCm38) unclassified probably benign
IGL01750:Kmt2d APN 15 98,853,168 (GRCm38) unclassified probably benign
IGL02163:Kmt2d APN 15 98,835,228 (GRCm38) unclassified probably benign
IGL02209:Kmt2d APN 15 98,854,567 (GRCm38) unclassified probably benign
IGL02253:Kmt2d APN 15 98,858,175 (GRCm38) unclassified probably benign
IGL02271:Kmt2d APN 15 98,866,428 (GRCm38) missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98,865,492 (GRCm38) splice site probably benign
IGL02448:Kmt2d APN 15 98,844,110 (GRCm38) unclassified probably benign
IGL02472:Kmt2d APN 15 98,850,077 (GRCm38) missense probably benign 0.23
IGL02496:Kmt2d APN 15 98,857,558 (GRCm38) unclassified probably benign
IGL02527:Kmt2d APN 15 98,841,747 (GRCm38) unclassified probably benign
IGL02576:Kmt2d APN 15 98,864,120 (GRCm38) missense unknown
IGL02597:Kmt2d APN 15 98,863,831 (GRCm38) missense unknown
IGL02609:Kmt2d APN 15 98,851,793 (GRCm38) unclassified probably benign
IGL03085:Kmt2d APN 15 98,839,940 (GRCm38) unclassified probably benign
IGL03102:Kmt2d APN 15 98,855,543 (GRCm38) missense probably benign
IGL03123:Kmt2d APN 15 98,861,771 (GRCm38) missense unknown
G1citation:Kmt2d UTSW 15 98,849,459 (GRCm38) unclassified probably benign
R0091:Kmt2d UTSW 15 98,844,479 (GRCm38) unclassified probably benign
R0136:Kmt2d UTSW 15 98,854,278 (GRCm38) unclassified probably benign
R0243:Kmt2d UTSW 15 98,850,137 (GRCm38) unclassified probably benign
R0276:Kmt2d UTSW 15 98,850,311 (GRCm38) unclassified probably benign
R0477:Kmt2d UTSW 15 98,853,581 (GRCm38) unclassified probably benign
R0586:Kmt2d UTSW 15 98,835,207 (GRCm38) unclassified probably benign
R0632:Kmt2d UTSW 15 98,853,581 (GRCm38) unclassified probably benign
R0678:Kmt2d UTSW 15 98,850,413 (GRCm38) unclassified probably benign
R0780:Kmt2d UTSW 15 98,862,857 (GRCm38) missense unknown
R0891:Kmt2d UTSW 15 98,852,691 (GRCm38) unclassified probably benign
R1136:Kmt2d UTSW 15 98,857,765 (GRCm38) unclassified probably benign
R1417:Kmt2d UTSW 15 98,866,430 (GRCm38) missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98,844,938 (GRCm38) unclassified probably benign
R1510:Kmt2d UTSW 15 98,856,377 (GRCm38) unclassified probably benign
R1586:Kmt2d UTSW 15 98,865,053 (GRCm38) splice site probably benign
R1640:Kmt2d UTSW 15 98,845,057 (GRCm38) unclassified probably benign
R1714:Kmt2d UTSW 15 98,862,950 (GRCm38) missense unknown
R1725:Kmt2d UTSW 15 98,845,234 (GRCm38) unclassified probably benign
R1728:Kmt2d UTSW 15 98,865,132 (GRCm38) missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98,865,132 (GRCm38) missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98,845,234 (GRCm38) unclassified probably benign
R1744:Kmt2d UTSW 15 98,865,047 (GRCm38) missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98,864,378 (GRCm38) missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98,843,482 (GRCm38) unclassified probably benign
R1782:Kmt2d UTSW 15 98,857,548 (GRCm38) unclassified probably benign
R1789:Kmt2d UTSW 15 98,852,074 (GRCm38) unclassified probably benign
R1802:Kmt2d UTSW 15 98,862,985 (GRCm38) missense unknown
R1808:Kmt2d UTSW 15 98,866,686 (GRCm38) missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98,861,780 (GRCm38) missense unknown
R1831:Kmt2d UTSW 15 98,855,343 (GRCm38) missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98,855,591 (GRCm38) missense probably damaging 1.00
R1920:Kmt2d UTSW 15 98,855,590 (GRCm38) missense probably damaging 0.96
R1956:Kmt2d UTSW 15 98,859,590 (GRCm38) unclassified probably benign
R2100:Kmt2d UTSW 15 98,846,480 (GRCm38) unclassified probably benign
R2120:Kmt2d UTSW 15 98,839,529 (GRCm38) unclassified probably benign
R2188:Kmt2d UTSW 15 98,839,300 (GRCm38) unclassified probably benign
R2191:Kmt2d UTSW 15 98,861,049 (GRCm38) critical splice donor site probably null
R2234:Kmt2d UTSW 15 98,865,248 (GRCm38) missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98,862,266 (GRCm38) missense unknown
R2762:Kmt2d UTSW 15 98,852,055 (GRCm38) unclassified probably benign
R2895:Kmt2d UTSW 15 98,843,939 (GRCm38) unclassified probably benign
R3624:Kmt2d UTSW 15 98,842,902 (GRCm38) unclassified probably benign
R3791:Kmt2d UTSW 15 98,844,149 (GRCm38) unclassified probably benign
R3794:Kmt2d UTSW 15 98,837,359 (GRCm38) unclassified probably benign
R3871:Kmt2d UTSW 15 98,851,021 (GRCm38) unclassified probably benign
R3958:Kmt2d UTSW 15 98,855,549 (GRCm38) missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98,846,046 (GRCm38) unclassified probably benign
R4211:Kmt2d UTSW 15 98,840,189 (GRCm38) unclassified probably benign
R4212:Kmt2d UTSW 15 98,845,003 (GRCm38) unclassified probably benign
R4240:Kmt2d UTSW 15 98,844,571 (GRCm38) unclassified probably benign
R4246:Kmt2d UTSW 15 98,840,089 (GRCm38) unclassified probably benign
R4361:Kmt2d UTSW 15 98,863,670 (GRCm38) missense unknown
R4388:Kmt2d UTSW 15 98,853,626 (GRCm38) unclassified probably benign
R4602:Kmt2d UTSW 15 98,850,259 (GRCm38) unclassified probably benign
R4606:Kmt2d UTSW 15 98,839,716 (GRCm38) unclassified probably benign
R4658:Kmt2d UTSW 15 98,852,529 (GRCm38) unclassified probably benign
R4840:Kmt2d UTSW 15 98,861,894 (GRCm38) missense unknown
R4895:Kmt2d UTSW 15 98,844,487 (GRCm38) unclassified probably benign
R4906:Kmt2d UTSW 15 98,849,539 (GRCm38) unclassified probably benign
R4976:Kmt2d UTSW 15 98,847,194 (GRCm38) utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98,856,162 (GRCm38) missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98,847,194 (GRCm38) utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98,840,224 (GRCm38) unclassified probably benign
R5260:Kmt2d UTSW 15 98,842,860 (GRCm38) unclassified probably benign
R5274:Kmt2d UTSW 15 98,854,230 (GRCm38) unclassified probably benign
R5450:Kmt2d UTSW 15 98,855,086 (GRCm38) missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5462:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5463:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5465:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5467:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5481:Kmt2d UTSW 15 98,862,005 (GRCm38) missense unknown
R5509:Kmt2d UTSW 15 98,839,676 (GRCm38) unclassified probably benign
R5534:Kmt2d UTSW 15 98,837,357 (GRCm38) unclassified probably benign
R5536:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5537:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5538:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5546:Kmt2d UTSW 15 98,853,068 (GRCm38) unclassified probably benign
R5595:Kmt2d UTSW 15 98,850,024 (GRCm38) unclassified probably benign
R5645:Kmt2d UTSW 15 98,844,397 (GRCm38) unclassified probably benign
R5679:Kmt2d UTSW 15 98,854,272 (GRCm38) unclassified probably benign
R5710:Kmt2d UTSW 15 98,854,106 (GRCm38) unclassified probably benign
R5755:Kmt2d UTSW 15 98,863,646 (GRCm38) missense unknown
R5817:Kmt2d UTSW 15 98,862,363 (GRCm38) missense unknown
R5841:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5842:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5843:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5844:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R5845:Kmt2d UTSW 15 98,852,109 (GRCm38) unclassified probably benign
R6122:Kmt2d UTSW 15 98,860,692 (GRCm38) unclassified probably benign
R6612:Kmt2d UTSW 15 98,845,858 (GRCm38) unclassified probably benign
R6718:Kmt2d UTSW 15 98,849,586 (GRCm38) unclassified probably benign
R6718:Kmt2d UTSW 15 98,850,539 (GRCm38) unclassified probably benign
R6822:Kmt2d UTSW 15 98,849,459 (GRCm38) unclassified probably benign
R6866:Kmt2d UTSW 15 98,857,393 (GRCm38) unclassified probably benign
R6950:Kmt2d UTSW 15 98,840,020 (GRCm38) unclassified probably benign
R7089:Kmt2d UTSW 15 98,850,272 (GRCm38) missense unknown
R7120:Kmt2d UTSW 15 98,861,065 (GRCm38) missense unknown
R7131:Kmt2d UTSW 15 98,849,616 (GRCm38) unclassified probably benign
R7177:Kmt2d UTSW 15 98,850,386 (GRCm38) missense unknown
R7194:Kmt2d UTSW 15 98,843,833 (GRCm38) missense unknown
R7252:Kmt2d UTSW 15 98,844,266 (GRCm38) missense unknown
R7282:Kmt2d UTSW 15 98,854,104 (GRCm38) missense unknown
R7307:Kmt2d UTSW 15 98,849,418 (GRCm38) missense unknown
R7313:Kmt2d UTSW 15 98,856,623 (GRCm38) missense unknown
R7394:Kmt2d UTSW 15 98,856,384 (GRCm38) missense unknown
R7404:Kmt2d UTSW 15 98,845,495 (GRCm38) missense unknown
R7409:Kmt2d UTSW 15 98,855,354 (GRCm38) missense probably damaging 1.00
R7414:Kmt2d UTSW 15 98,839,856 (GRCm38) missense unknown
R7534:Kmt2d UTSW 15 98,852,018 (GRCm38) missense unknown
R7575:Kmt2d UTSW 15 98,849,611 (GRCm38) unclassified probably benign
R7650:Kmt2d UTSW 15 98,850,870 (GRCm38) missense unknown
R7687:Kmt2d UTSW 15 98,862,120 (GRCm38) missense unknown
R7699:Kmt2d UTSW 15 98,843,719 (GRCm38) missense unknown
R7700:Kmt2d UTSW 15 98,843,719 (GRCm38) missense unknown
R7765:Kmt2d UTSW 15 98,852,334 (GRCm38) missense unknown
R7797:Kmt2d UTSW 15 98,864,406 (GRCm38) missense probably benign 0.24
R7803:Kmt2d UTSW 15 98,862,923 (GRCm38) missense unknown
R7952:Kmt2d UTSW 15 98,850,768 (GRCm38) missense unknown
R8054:Kmt2d UTSW 15 98,843,925 (GRCm38) missense unknown
R8084:Kmt2d UTSW 15 98,842,064 (GRCm38) missense unknown
R8089:Kmt2d UTSW 15 98,842,869 (GRCm38) missense unknown
R8133:Kmt2d UTSW 15 98,864,942 (GRCm38) missense probably damaging 1.00
R8138:Kmt2d UTSW 15 98,843,653 (GRCm38) missense unknown
R8343:Kmt2d UTSW 15 98,852,597 (GRCm38) missense unknown
R8681:Kmt2d UTSW 15 98,846,067 (GRCm38) missense unknown
R8694:Kmt2d UTSW 15 98,844,734 (GRCm38) missense unknown
R8837:Kmt2d UTSW 15 98,864,167 (GRCm38) missense unknown
R8855:Kmt2d UTSW 15 98,856,356 (GRCm38) missense unknown
R8934:Kmt2d UTSW 15 98,861,886 (GRCm38) missense unknown
R9100:Kmt2d UTSW 15 98,849,951 (GRCm38) missense unknown
R9158:Kmt2d UTSW 15 98,843,139 (GRCm38) missense unknown
R9190:Kmt2d UTSW 15 98,852,015 (GRCm38) missense unknown
R9222:Kmt2d UTSW 15 98,849,443 (GRCm38) missense unknown
R9263:Kmt2d UTSW 15 98,849,618 (GRCm38) frame shift probably null
R9336:Kmt2d UTSW 15 98,845,816 (GRCm38) missense unknown
R9397:Kmt2d UTSW 15 98,850,113 (GRCm38) missense unknown
R9415:Kmt2d UTSW 15 98,839,705 (GRCm38) missense unknown
R9482:Kmt2d UTSW 15 98,865,165 (GRCm38) missense probably damaging 1.00
R9529:Kmt2d UTSW 15 98,839,768 (GRCm38) missense unknown
R9610:Kmt2d UTSW 15 98,845,176 (GRCm38) unclassified probably benign
R9611:Kmt2d UTSW 15 98,845,176 (GRCm38) unclassified probably benign
R9611:Kmt2d UTSW 15 98,845,173 (GRCm38) unclassified probably benign
R9612:Kmt2d UTSW 15 98,845,176 (GRCm38) unclassified probably benign
R9613:Kmt2d UTSW 15 98,845,176 (GRCm38) unclassified probably benign
R9644:Kmt2d UTSW 15 98,845,504 (GRCm38) missense unknown
R9716:Kmt2d UTSW 15 98,843,402 (GRCm38) missense unknown
R9763:Kmt2d UTSW 15 98,845,176 (GRCm38) unclassified probably benign
R9782:Kmt2d UTSW 15 98,866,716 (GRCm38) missense probably damaging 1.00
X0018:Kmt2d UTSW 15 98,852,922 (GRCm38) unclassified probably benign
X0024:Kmt2d UTSW 15 98,853,053 (GRCm38) unclassified probably benign
X0062:Kmt2d UTSW 15 98,849,819 (GRCm38) unclassified probably benign
Z1187:Kmt2d UTSW 15 98,851,744 (GRCm38) missense unknown
Z1188:Kmt2d UTSW 15 98,851,744 (GRCm38) missense unknown
Z1189:Kmt2d UTSW 15 98,851,744 (GRCm38) missense unknown
Z1190:Kmt2d UTSW 15 98,851,744 (GRCm38) missense unknown
Z1192:Kmt2d UTSW 15 98,851,744 (GRCm38) missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGGTAGTATGAAATTCCCCTGGC -3'
(R):5'- TGTCCTGTGTCCCTCAGCAAAAGG -3'

Sequencing Primer
(F):5'- CAGTCCCAGGTCGAGTTGTG -3'
(R):5'- AGATAACCGGGCTGCTCAC -3'
Posted On 2013-05-23