Incidental Mutation 'R0478:Ets2'
ID43219
Institutional Source Beutler Lab
Gene Symbol Ets2
Ensembl Gene ENSMUSG00000022895
Gene NameE26 avian leukemia oncogene 2, 3' domain
SynonymsEts-2
MMRRC Submission 038678-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0478 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location95702407-95721045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95716262 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 346 (P346Q)
Ref Sequence ENSEMBL: ENSMUSP00000023612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023612]
Predicted Effect probably damaging
Transcript: ENSMUST00000023612
AA Change: P346Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023612
Gene: ENSMUSG00000022895
AA Change: P346Q

DomainStartEndE-ValueType
SAM_PNT 87 170 3.35e-43 SMART
low complexity region 259 269 N/A INTRINSIC
ETS 361 446 8.49e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143554
Meta Mutation Damage Score 0.1591 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defective trophoblast formation and die by embryonic day 8.5, but tetraploid chimeric rescue results in viable and fertile mutants with wavy hair. Mammary tumors induced in carriers are reduced in size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,562,589 noncoding transcript Het
4930556J24Rik T G 11: 3,976,259 probably benign Het
Acnat1 T G 4: 49,450,901 D70A probably damaging Het
Adnp2 A G 18: 80,129,334 V620A probably benign Het
Aldoart1 T A 4: 72,852,343 H21L probably benign Het
Birc3 A G 9: 7,860,347 V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 probably benign Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Clmn A G 12: 104,785,491 M235T probably damaging Het
Dmbt1 A G 7: 131,041,187 E245G possibly damaging Het
Epgn G T 5: 91,031,128 V36L probably benign Het
Fam222b T C 11: 78,153,856 L81P probably damaging Het
Fancf A C 7: 51,861,692 L188R probably damaging Het
Fibin T C 2: 110,362,734 D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 probably null Het
Gbp4 T A 5: 105,119,433 Q540L probably benign Het
Greb1l T A 18: 10,509,281 L531Q probably damaging Het
Il5ra A G 6: 106,738,462 V137A probably benign Het
Kif26a G A 12: 112,175,789 A826T probably damaging Het
Kiz T C 2: 146,942,158 V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 G15D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lbp T C 2: 158,317,528 probably benign Het
Mmp25 T C 17: 23,632,782 T318A probably benign Het
Mrpl50 A G 4: 49,514,513 C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 probably null Het
Noc3l A G 19: 38,810,006 probably null Het
Olfr1126 T A 2: 87,458,026 V287E probably damaging Het
Olfr1375 T C 11: 51,048,712 S202P probably benign Het
Pgm5 A T 19: 24,834,869 S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 S350T probably damaging Het
Ptk2b G T 14: 66,213,372 N48K probably damaging Het
Sept3 T C 15: 82,290,806 L172P probably damaging Het
Sirt3 A T 7: 140,878,114 C41S probably benign Het
Sphkap C T 1: 83,278,711 R152H probably damaging Het
St3gal1 T C 15: 67,113,730 Y25C probably damaging Het
Tbc1d31 T C 15: 57,932,536 F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 D43E probably benign Het
Tgm1 G A 14: 55,700,334 Q773* probably null Het
Tmc3 A T 7: 83,622,152 R837S possibly damaging Het
Unc13a A G 8: 71,651,148 V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 V268E probably damaging Het
Zan C T 5: 137,400,526 probably benign Het
Zfp760 G T 17: 21,722,014 E57* probably null Het
Other mutations in Ets2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Ets2 APN 16 95712141 missense probably benign 0.01
IGL00843:Ets2 APN 16 95709793 missense probably benign 0.03
IGL01911:Ets2 APN 16 95711758 missense probably damaging 1.00
R0257:Ets2 UTSW 16 95712201 nonsense probably null
R0317:Ets2 UTSW 16 95712149 missense probably damaging 1.00
R0398:Ets2 UTSW 16 95716223 missense probably damaging 1.00
R0634:Ets2 UTSW 16 95716156 missense possibly damaging 0.87
R1621:Ets2 UTSW 16 95709869 missense probably damaging 1.00
R1868:Ets2 UTSW 16 95715074 missense probably benign 0.00
R2120:Ets2 UTSW 16 95718933 missense probably benign 0.17
R3037:Ets2 UTSW 16 95716065 missense probably benign 0.19
R3915:Ets2 UTSW 16 95718993 missense probably damaging 1.00
R4086:Ets2 UTSW 16 95709789 missense probably damaging 1.00
R4609:Ets2 UTSW 16 95711774 missense probably benign 0.03
R4760:Ets2 UTSW 16 95719043 missense probably damaging 1.00
R5245:Ets2 UTSW 16 95712260 nonsense probably null
R5551:Ets2 UTSW 16 95712121 missense probably damaging 1.00
R6057:Ets2 UTSW 16 95714372 missense probably benign 0.00
R6376:Ets2 UTSW 16 95718993 missense probably damaging 1.00
R7545:Ets2 UTSW 16 95715083 missense probably benign 0.45
R7905:Ets2 UTSW 16 95706437 missense probably damaging 0.97
R7988:Ets2 UTSW 16 95706437 missense probably damaging 0.97
R8013:Ets2 UTSW 16 95716100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGTGTGTATAGCTGCCTTG -3'
(R):5'- ATCCAGAGTGTGAGTCAGAGCCAG -3'

Sequencing Primer
(F):5'- GATGCTCCTGAATTAATGACCCAG -3'
(R):5'- AGTCAGAGCCAGAGTCTGTC -3'
Posted On2013-05-23