Incidental Mutation 'R0478:Zfp760'
ID43221
Institutional Source Beutler Lab
Gene Symbol Zfp760
Ensembl Gene ENSMUSG00000067928
Gene Namezinc finger protein 760
Synonyms
MMRRC Submission 038678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0478 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21707741-21725636 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 21722014 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 57 (E57*)
Ref Sequence ENSEMBL: ENSMUSP00000073038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073312]
Predicted Effect probably null
Transcript: ENSMUST00000073312
AA Change: E57*
SMART Domains Protein: ENSMUSP00000073038
Gene: ENSMUSG00000067928
AA Change: E57*

DomainStartEndE-ValueType
KRAB 8 69 3.62e-21 SMART
ZnF_C2H2 183 202 1.78e2 SMART
ZnF_C2H2 208 230 1.69e-3 SMART
ZnF_C2H2 236 258 4.54e-4 SMART
ZnF_C2H2 264 286 2.79e-4 SMART
ZnF_C2H2 292 314 1.1e-2 SMART
ZnF_C2H2 320 342 2.71e-2 SMART
ZnF_C2H2 348 370 7.9e-4 SMART
ZnF_C2H2 376 398 1.72e-4 SMART
ZnF_C2H2 404 426 1.14e0 SMART
ZnF_C2H2 432 454 4.05e-1 SMART
ZnF_C2H2 460 482 5.14e-3 SMART
ZnF_C2H2 488 510 1.18e-2 SMART
ZnF_C2H2 516 538 1.95e-3 SMART
ZnF_C2H2 544 566 1.82e-3 SMART
ZnF_C2H2 572 594 4.17e-3 SMART
ZnF_C2H2 600 622 1.04e-3 SMART
ZnF_C2H2 628 650 1.28e-3 SMART
Meta Mutation Damage Score 0.9185 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,562,589 noncoding transcript Het
4930556J24Rik T G 11: 3,976,259 probably benign Het
Acnat1 T G 4: 49,450,901 D70A probably damaging Het
Adnp2 A G 18: 80,129,334 V620A probably benign Het
Aldoart1 T A 4: 72,852,343 H21L probably benign Het
Birc3 A G 9: 7,860,347 V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 probably benign Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Clmn A G 12: 104,785,491 M235T probably damaging Het
Dmbt1 A G 7: 131,041,187 E245G possibly damaging Het
Epgn G T 5: 91,031,128 V36L probably benign Het
Ets2 C A 16: 95,716,262 P346Q probably damaging Het
Fam222b T C 11: 78,153,856 L81P probably damaging Het
Fancf A C 7: 51,861,692 L188R probably damaging Het
Fibin T C 2: 110,362,734 D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 probably null Het
Gbp4 T A 5: 105,119,433 Q540L probably benign Het
Greb1l T A 18: 10,509,281 L531Q probably damaging Het
Il5ra A G 6: 106,738,462 V137A probably benign Het
Kif26a G A 12: 112,175,789 A826T probably damaging Het
Kiz T C 2: 146,942,158 V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 G15D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lbp T C 2: 158,317,528 probably benign Het
Mmp25 T C 17: 23,632,782 T318A probably benign Het
Mrpl50 A G 4: 49,514,513 C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 probably null Het
Noc3l A G 19: 38,810,006 probably null Het
Olfr1126 T A 2: 87,458,026 V287E probably damaging Het
Olfr1375 T C 11: 51,048,712 S202P probably benign Het
Pgm5 A T 19: 24,834,869 S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 S350T probably damaging Het
Ptk2b G T 14: 66,213,372 N48K probably damaging Het
Sept3 T C 15: 82,290,806 L172P probably damaging Het
Sirt3 A T 7: 140,878,114 C41S probably benign Het
Sphkap C T 1: 83,278,711 R152H probably damaging Het
St3gal1 T C 15: 67,113,730 Y25C probably damaging Het
Tbc1d31 T C 15: 57,932,536 F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 D43E probably benign Het
Tgm1 G A 14: 55,700,334 Q773* probably null Het
Tmc3 A T 7: 83,622,152 R837S possibly damaging Het
Unc13a A G 8: 71,651,148 V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 V268E probably damaging Het
Zan C T 5: 137,400,526 probably benign Het
Other mutations in Zfp760
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Zfp760 APN 17 21723476 missense possibly damaging 0.75
IGL00862:Zfp760 APN 17 21722284 missense probably benign 0.00
IGL02198:Zfp760 APN 17 21722212 missense probably benign 0.00
R0835:Zfp760 UTSW 17 21723578 missense possibly damaging 0.63
R1191:Zfp760 UTSW 17 21723305 missense probably damaging 1.00
R1760:Zfp760 UTSW 17 21722330 missense probably damaging 1.00
R2698:Zfp760 UTSW 17 21720954 missense probably damaging 0.99
R3722:Zfp760 UTSW 17 21722162 missense probably damaging 1.00
R4561:Zfp760 UTSW 17 21723667 missense probably benign 0.00
R4700:Zfp760 UTSW 17 21722407 missense probably benign 0.01
R4859:Zfp760 UTSW 17 21723530 missense probably damaging 0.97
R4859:Zfp760 UTSW 17 21723535 nonsense probably null
R4897:Zfp760 UTSW 17 21723248 missense probably benign 0.02
R6675:Zfp760 UTSW 17 21723010 missense possibly damaging 0.92
R7286:Zfp760 UTSW 17 21722779 missense probably benign 0.04
R7336:Zfp760 UTSW 17 21723833 missense unknown
R7356:Zfp760 UTSW 17 21722620 missense probably benign
R7369:Zfp760 UTSW 17 21723233 missense probably benign 0.00
R7504:Zfp760 UTSW 17 21722674 missense probably damaging 0.97
R7553:Zfp760 UTSW 17 21722891 missense possibly damaging 0.82
R7577:Zfp760 UTSW 17 21722261 nonsense probably null
R7579:Zfp760 UTSW 17 21722926 missense possibly damaging 0.93
R7608:Zfp760 UTSW 17 21722816 missense probably benign 0.00
X0057:Zfp760 UTSW 17 21723682 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CATCAATCCCCACAGTGTGATGGAG -3'
(R):5'- TGATTCAATGGAAGCATCCTGGTAGC -3'

Sequencing Primer
(F):5'- TGGAGGTTCTGAACATCCATAC -3'
(R):5'- AAGCATCCTGGTAGCTGTACTTG -3'
Posted On2013-05-23