Incidental Mutation 'R5494:Atrn'
ID 432222
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission 043055-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5494 (G1)
Quality Score 194
Status Not validated
Chromosome 2
Chromosomal Location 130748415-130872253 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130864995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1374 (L1374P)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably damaging
Transcript: ENSMUST00000028781
AA Change: L1374P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: L1374P

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,223,165 (GRCm39) E436G probably damaging Het
Aldh18a1 C T 19: 40,539,734 (GRCm39) R747Q probably damaging Het
Apob A G 12: 8,061,762 (GRCm39) N3415D probably damaging Het
Asb18 T C 1: 89,882,121 (GRCm39) E139G probably damaging Het
Ccdc81 A G 7: 89,526,781 (GRCm39) S410P probably damaging Het
Cep112 A G 11: 108,555,431 (GRCm39) E809G probably damaging Het
Dctn1 G T 6: 83,159,546 (GRCm39) R8L possibly damaging Het
Ddn C A 15: 98,704,884 (GRCm39) R82L probably damaging Het
Dgkz A T 2: 91,771,394 (GRCm39) probably null Het
Eif4a3l1 C G 6: 136,306,555 (GRCm39) R339G probably damaging Het
Frem1 T C 4: 82,858,990 (GRCm39) *415W probably null Het
Fry A T 5: 150,314,132 (GRCm39) D789V probably damaging Het
Fzr1 C T 10: 81,207,178 (GRCm39) probably null Het
Gemin5 T A 11: 58,021,526 (GRCm39) Y1025F probably damaging Het
Gjb5 C T 4: 127,249,347 (GRCm39) V266M probably damaging Het
Gli3 A T 13: 15,900,567 (GRCm39) Q1318L probably benign Het
Golgb1 T A 16: 36,749,045 (GRCm39) N3056K possibly damaging Het
Gucy1b1 T A 3: 81,947,183 (GRCm39) D342V probably damaging Het
H1f9 T C 11: 94,858,843 (GRCm39) L46S probably benign Het
Hc A T 2: 34,893,551 (GRCm39) probably null Het
Heg1 A G 16: 33,545,804 (GRCm39) D185G probably benign Het
Igf2r A T 17: 12,912,032 (GRCm39) M1865K possibly damaging Het
Il27 A G 7: 126,192,100 (GRCm39) L12P probably damaging Het
Krt1 C T 15: 101,759,149 (GRCm39) C5Y unknown Het
Med25 C T 7: 44,535,225 (GRCm39) V170M probably damaging Het
Mgat4a T A 1: 37,493,898 (GRCm39) Y316F probably damaging Het
Oas3 A G 5: 120,899,709 (GRCm39) V725A unknown Het
Or52ac1 C A 7: 104,245,932 (GRCm39) G152V probably damaging Het
Or5w16 T C 2: 87,576,950 (GRCm39) S137P probably damaging Het
Pcdhb17 T C 18: 37,620,300 (GRCm39) S697P probably damaging Het
Plch2 T C 4: 155,075,579 (GRCm39) Y751C probably damaging Het
Rbms2 G T 10: 127,973,560 (GRCm39) T252N probably damaging Het
Rbpjl GCC GC 2: 164,256,330 (GRCm39) probably null Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Scfd1 A G 12: 51,443,522 (GRCm39) probably null Het
Shank3 C T 15: 89,432,441 (GRCm39) T1062M probably damaging Het
Slc28a1 G A 7: 80,817,787 (GRCm39) G552E probably damaging Het
Sntn A G 14: 13,682,214 (GRCm38) R96G probably benign Het
Tas2r102 T C 6: 132,740,106 (GRCm39) V338A probably benign Het
Trim62 A T 4: 128,778,999 (GRCm39) N145Y possibly damaging Het
Tspoap1 C T 11: 87,666,031 (GRCm39) T863I possibly damaging Het
Ubr5 C T 15: 38,019,525 (GRCm39) C739Y possibly damaging Het
Vps13c G A 9: 67,855,428 (GRCm39) V2498I probably benign Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130,799,999 (GRCm39) missense probably damaging 1.00
IGL00571:Atrn APN 2 130,836,968 (GRCm39) missense probably damaging 1.00
IGL01092:Atrn APN 2 130,789,556 (GRCm39) nonsense probably null
IGL01572:Atrn APN 2 130,844,715 (GRCm39) missense probably damaging 1.00
IGL01924:Atrn APN 2 130,777,485 (GRCm39) missense probably damaging 1.00
IGL02116:Atrn APN 2 130,800,009 (GRCm39) missense probably damaging 1.00
IGL02372:Atrn APN 2 130,844,674 (GRCm39) splice site probably benign
IGL02390:Atrn APN 2 130,862,897 (GRCm39) missense possibly damaging 0.82
IGL02548:Atrn APN 2 130,814,202 (GRCm39) missense probably damaging 1.00
IGL02749:Atrn APN 2 130,789,654 (GRCm39) splice site probably benign
IGL02749:Atrn APN 2 130,812,064 (GRCm39) nonsense probably null
BB010:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
BB020:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R0026:Atrn UTSW 2 130,799,840 (GRCm39) missense probably damaging 1.00
R0403:Atrn UTSW 2 130,748,779 (GRCm39) missense probably damaging 1.00
R0479:Atrn UTSW 2 130,841,085 (GRCm39) nonsense probably null
R0544:Atrn UTSW 2 130,828,746 (GRCm39) missense probably damaging 1.00
R0570:Atrn UTSW 2 130,822,054 (GRCm39) missense probably benign 0.01
R0606:Atrn UTSW 2 130,748,776 (GRCm39) missense possibly damaging 0.90
R0617:Atrn UTSW 2 130,837,005 (GRCm39) critical splice donor site probably null
R0658:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R1108:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1112:Atrn UTSW 2 130,841,081 (GRCm39) missense probably benign 0.04
R1219:Atrn UTSW 2 130,862,927 (GRCm39) missense possibly damaging 0.90
R1422:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1524:Atrn UTSW 2 130,799,000 (GRCm39) missense probably benign 0.15
R1653:Atrn UTSW 2 130,777,544 (GRCm39) missense probably benign
R1795:Atrn UTSW 2 130,814,208 (GRCm39) missense probably benign
R1807:Atrn UTSW 2 130,824,692 (GRCm39) missense possibly damaging 0.94
R1920:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1921:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1935:Atrn UTSW 2 130,799,955 (GRCm39) missense probably damaging 1.00
R1982:Atrn UTSW 2 130,812,142 (GRCm39) missense probably benign
R2000:Atrn UTSW 2 130,777,508 (GRCm39) missense probably damaging 1.00
R2143:Atrn UTSW 2 130,799,916 (GRCm39) missense probably benign 0.03
R2336:Atrn UTSW 2 130,799,874 (GRCm39) missense probably damaging 1.00
R2679:Atrn UTSW 2 130,803,595 (GRCm39) critical splice donor site probably null
R3426:Atrn UTSW 2 130,862,876 (GRCm39) missense probably benign 0.06
R3909:Atrn UTSW 2 130,836,127 (GRCm39) missense probably damaging 1.00
R4077:Atrn UTSW 2 130,806,850 (GRCm39) critical splice donor site probably null
R4162:Atrn UTSW 2 130,836,148 (GRCm39) splice site probably benign
R4195:Atrn UTSW 2 130,775,332 (GRCm39) missense probably damaging 1.00
R4364:Atrn UTSW 2 130,812,128 (GRCm39) missense probably benign 0.39
R4465:Atrn UTSW 2 130,802,388 (GRCm39) missense probably benign 0.08
R4510:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4511:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4527:Atrn UTSW 2 130,815,424 (GRCm39) missense probably benign 0.10
R4586:Atrn UTSW 2 130,823,962 (GRCm39) missense probably damaging 1.00
R4592:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R4658:Atrn UTSW 2 130,775,349 (GRCm39) missense probably damaging 1.00
R4735:Atrn UTSW 2 130,862,910 (GRCm39) missense probably benign 0.06
R4960:Atrn UTSW 2 130,836,967 (GRCm39) nonsense probably null
R4999:Atrn UTSW 2 130,817,874 (GRCm39) missense probably damaging 1.00
R5066:Atrn UTSW 2 130,836,113 (GRCm39) missense possibly damaging 0.60
R5080:Atrn UTSW 2 130,812,044 (GRCm39) missense possibly damaging 0.95
R5141:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R5256:Atrn UTSW 2 130,787,939 (GRCm39) missense probably benign 0.39
R5678:Atrn UTSW 2 130,811,936 (GRCm39) missense probably damaging 0.96
R5752:Atrn UTSW 2 130,748,464 (GRCm39) unclassified probably benign
R5931:Atrn UTSW 2 130,775,356 (GRCm39) missense possibly damaging 0.56
R6023:Atrn UTSW 2 130,862,900 (GRCm39) missense probably benign 0.25
R6176:Atrn UTSW 2 130,788,011 (GRCm39) missense probably benign 0.31
R6377:Atrn UTSW 2 130,821,889 (GRCm39) missense probably damaging 1.00
R6433:Atrn UTSW 2 130,864,947 (GRCm39) missense probably damaging 1.00
R7226:Atrn UTSW 2 130,828,664 (GRCm39) missense probably damaging 0.99
R7402:Atrn UTSW 2 130,789,520 (GRCm39) missense probably damaging 1.00
R7541:Atrn UTSW 2 130,803,491 (GRCm39) missense possibly damaging 0.46
R7587:Atrn UTSW 2 130,822,034 (GRCm39) missense probably damaging 1.00
R7872:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R7910:Atrn UTSW 2 130,806,807 (GRCm39) missense probably benign 0.04
R7913:Atrn UTSW 2 130,812,131 (GRCm39) missense probably damaging 1.00
R7933:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R8044:Atrn UTSW 2 130,777,449 (GRCm39) missense probably damaging 1.00
R8079:Atrn UTSW 2 130,855,561 (GRCm39) missense probably null 1.00
R8093:Atrn UTSW 2 130,817,908 (GRCm39) missense probably benign 0.00
R8203:Atrn UTSW 2 130,802,469 (GRCm39) missense probably benign 0.00
R8234:Atrn UTSW 2 130,864,920 (GRCm39) critical splice acceptor site probably null
R8462:Atrn UTSW 2 130,777,504 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,846,494 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,748,798 (GRCm39) missense probably damaging 1.00
R8831:Atrn UTSW 2 130,748,521 (GRCm39) missense probably benign 0.22
R8937:Atrn UTSW 2 130,841,157 (GRCm39) missense probably benign 0.00
R9161:Atrn UTSW 2 130,777,470 (GRCm39) missense probably damaging 1.00
R9722:Atrn UTSW 2 130,803,536 (GRCm39) missense probably damaging 1.00
R9786:Atrn UTSW 2 130,786,809 (GRCm39) missense probably damaging 1.00
RF009:Atrn UTSW 2 130,748,842 (GRCm39) missense probably benign 0.12
X0024:Atrn UTSW 2 130,800,059 (GRCm39) missense probably damaging 1.00
Z1088:Atrn UTSW 2 130,815,319 (GRCm39) missense probably benign
Z1176:Atrn UTSW 2 130,788,113 (GRCm39) missense probably benign 0.27
Z1177:Atrn UTSW 2 130,787,962 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCCTGACACTCACACAGC -3'
(R):5'- GGACAGGAATGTCAGTGCTCAG -3'

Sequencing Primer
(F):5'- TCACACAGCTCTCGGGACAG -3'
(R):5'- GTCAGTGCTCAGAACACAGTTTG -3'
Posted On 2016-10-05