Incidental Mutation 'R5494:Oas3'
ID432230
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name2'-5' oligoadenylate synthetase 3
SynonymsOasl10, 2'-5' oligoadenylate synthetase-like 10
MMRRC Submission 043055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5494 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120753098-120777661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120761644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 725 (V725A)
Ref Sequence ENSEMBL: ENSMUSP00000035588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833]
Predicted Effect unknown
Transcript: ENSMUST00000044833
AA Change: V725A
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: V725A

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200795
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,347,169 E436G probably damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Apob A G 12: 8,011,762 N3415D probably damaging Het
Asb18 T C 1: 89,954,399 E139G probably damaging Het
Atrn T C 2: 131,023,075 L1374P probably damaging Het
Ccdc81 A G 7: 89,877,573 S410P probably damaging Het
Cep112 A G 11: 108,664,605 E809G probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Ddn C A 15: 98,807,003 R82L probably damaging Het
Dgkz A T 2: 91,941,049 probably null Het
Frem1 T C 4: 82,940,753 *415W probably null Het
Fry A T 5: 150,390,667 D789V probably damaging Het
Fzr1 C T 10: 81,371,344 probably null Het
Gemin5 T A 11: 58,130,700 Y1025F probably damaging Het
Gjb5 C T 4: 127,355,554 V266M probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Golgb1 T A 16: 36,928,683 N3056K possibly damaging Het
Gucy1b1 T A 3: 82,039,876 D342V probably damaging Het
Hc A T 2: 35,003,539 probably null Het
Heg1 A G 16: 33,725,434 D185G probably benign Het
Hils1 T C 11: 94,968,017 L46S probably benign Het
Igf2r A T 17: 12,693,145 M1865K possibly damaging Het
Il27 A G 7: 126,592,928 L12P probably damaging Het
Krt1 C T 15: 101,850,714 C5Y unknown Het
Med25 C T 7: 44,885,801 V170M probably damaging Het
Mgat4a T A 1: 37,454,817 Y316F probably damaging Het
Olfr1140 T C 2: 87,746,606 S137P probably damaging Het
Olfr655 C A 7: 104,596,725 G152V probably damaging Het
Pcdhb17 T C 18: 37,487,247 S697P probably damaging Het
Plch2 T C 4: 154,991,122 Y751C probably damaging Het
Rbms2 G T 10: 128,137,691 T252N probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scfd1 A G 12: 51,396,739 probably null Het
Shank3 C T 15: 89,548,238 T1062M probably damaging Het
Slc28a1 G A 7: 81,168,039 G552E probably damaging Het
Sntn A G 14: 13,682,214 R96G probably benign Het
Tas2r102 T C 6: 132,763,143 V338A probably benign Het
Trim62 A T 4: 128,885,206 N145Y possibly damaging Het
Tspoap1 C T 11: 87,775,205 T863I possibly damaging Het
Ubr5 C T 15: 38,019,281 C739Y possibly damaging Het
Vps13c G A 9: 67,948,146 V2498I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0592:Oas3 UTSW 5 120771149 missense probably damaging 1.00
R0946:Oas3 UTSW 5 120769063 missense unknown
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
R8022:Oas3 UTSW 5 120756966 missense possibly damaging 0.91
RF006:Oas3 UTSW 5 120774100 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGGAGTCCATGCTTCCTC -3'
(R):5'- GGTTGTCACTCGATATAAAGGAGG -3'

Sequencing Primer
(F):5'- TGCTTCCTCATCAGAATCCAGAGG -3'
(R):5'- TCACTCGATATAAAGGAGGAGAGGC -3'
Posted On2016-10-05