Incidental Mutation 'R5494:Tas2r102'
ID432233
Institutional Source Beutler Lab
Gene Symbol Tas2r102
Ensembl Gene ENSMUSG00000056901
Gene Nametaste receptor, type 2, member 102
SynonymsTas2r2, mt2r51, mGR02, STC 9-7
MMRRC Submission 043055-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5494 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132762131-132763174 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132763143 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 338 (V338A)
Ref Sequence ENSEMBL: ENSMUSP00000068332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069268]
Predicted Effect probably benign
Transcript: ENSMUST00000069268
AA Change: V338A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000068332
Gene: ENSMUSG00000056901
AA Change: V338A

DomainStartEndE-ValueType
Pfam:TAS2R 21 317 3.6e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204939
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,347,169 E436G probably damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Apob A G 12: 8,011,762 N3415D probably damaging Het
Asb18 T C 1: 89,954,399 E139G probably damaging Het
Atrn T C 2: 131,023,075 L1374P probably damaging Het
Ccdc81 A G 7: 89,877,573 S410P probably damaging Het
Cep112 A G 11: 108,664,605 E809G probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Ddn C A 15: 98,807,003 R82L probably damaging Het
Dgkz A T 2: 91,941,049 probably null Het
Frem1 T C 4: 82,940,753 *415W probably null Het
Fry A T 5: 150,390,667 D789V probably damaging Het
Fzr1 C T 10: 81,371,344 probably null Het
Gemin5 T A 11: 58,130,700 Y1025F probably damaging Het
Gjb5 C T 4: 127,355,554 V266M probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Golgb1 T A 16: 36,928,683 N3056K possibly damaging Het
Gucy1b1 T A 3: 82,039,876 D342V probably damaging Het
Hc A T 2: 35,003,539 probably null Het
Heg1 A G 16: 33,725,434 D185G probably benign Het
Hils1 T C 11: 94,968,017 L46S probably benign Het
Igf2r A T 17: 12,693,145 M1865K possibly damaging Het
Il27 A G 7: 126,592,928 L12P probably damaging Het
Krt1 C T 15: 101,850,714 C5Y unknown Het
Med25 C T 7: 44,885,801 V170M probably damaging Het
Mgat4a T A 1: 37,454,817 Y316F probably damaging Het
Oas3 A G 5: 120,761,644 V725A unknown Het
Olfr1140 T C 2: 87,746,606 S137P probably damaging Het
Olfr655 C A 7: 104,596,725 G152V probably damaging Het
Pcdhb17 T C 18: 37,487,247 S697P probably damaging Het
Plch2 T C 4: 154,991,122 Y751C probably damaging Het
Rbms2 G T 10: 128,137,691 T252N probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scfd1 A G 12: 51,396,739 probably null Het
Shank3 C T 15: 89,548,238 T1062M probably damaging Het
Slc28a1 G A 7: 81,168,039 G552E probably damaging Het
Sntn A G 14: 13,682,214 R96G probably benign Het
Trim62 A T 4: 128,885,206 N145Y possibly damaging Het
Tspoap1 C T 11: 87,775,205 T863I possibly damaging Het
Ubr5 C T 15: 38,019,281 C739Y possibly damaging Het
Vps13c G A 9: 67,948,146 V2498I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Tas2r102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Tas2r102 APN 6 132762525 missense possibly damaging 0.58
IGL01777:Tas2r102 APN 6 132762852 missense probably damaging 0.98
IGL01956:Tas2r102 APN 6 132762453 nonsense probably null
IGL02126:Tas2r102 APN 6 132762644 missense probably damaging 1.00
IGL02650:Tas2r102 APN 6 132762210 missense probably null 0.00
R0483:Tas2r102 UTSW 6 132762365 missense probably damaging 1.00
R0573:Tas2r102 UTSW 6 132762673 missense probably damaging 0.98
R0726:Tas2r102 UTSW 6 132762452 missense probably damaging 1.00
R1777:Tas2r102 UTSW 6 132762291 missense probably benign 0.08
R3615:Tas2r102 UTSW 6 132762818 nonsense probably null
R3616:Tas2r102 UTSW 6 132762818 nonsense probably null
R4556:Tas2r102 UTSW 6 132762915 missense probably damaging 1.00
R4633:Tas2r102 UTSW 6 132762679 missense possibly damaging 0.87
R4724:Tas2r102 UTSW 6 132762557 missense probably damaging 0.97
R5268:Tas2r102 UTSW 6 132762397 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCATCAGAGTGAACTGGC -3'
(R):5'- GCCACCATTGTTCCAGCATATC -3'

Sequencing Primer
(F):5'- CAGAGTGAACTGGCTGATATTATTG -3'
(R):5'- CTGCAGCCAGGATAGGTTATAGC -3'
Posted On2016-10-05