Incidental Mutation 'R5494:Fzr1'
ID432245
Institutional Source Beutler Lab
Gene Symbol Fzr1
Ensembl Gene ENSMUSG00000020235
Gene Namefizzy and cell division cycle 20 related 1
SynonymsCdh1, Fyr
MMRRC Submission 043055-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5494 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location81366222-81378516 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 81371344 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020457] [ENSMUST00000118812] [ENSMUST00000118812] [ENSMUST00000140901]
Predicted Effect probably benign
Transcript: ENSMUST00000020457
SMART Domains Protein: ENSMUSP00000020457
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
Blast:WD40 172 213 8e-21 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.55e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118812
SMART Domains Protein: ENSMUSP00000112868
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
WD40 129 168 5.6e-3 SMART
WD40 171 208 6.79e-2 SMART
WD40 213 252 3.99e-8 SMART
WD40 255 297 2.84e-4 SMART
WD40 300 340 1.98e1 SMART
WD40 343 382 1.11e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118812
SMART Domains Protein: ENSMUSP00000112868
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
WD40 129 168 5.6e-3 SMART
WD40 171 208 6.79e-2 SMART
WD40 213 252 3.99e-8 SMART
WD40 255 297 2.84e-4 SMART
WD40 300 340 1.98e1 SMART
WD40 343 382 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138343
Predicted Effect probably null
Transcript: ENSMUST00000140901
SMART Domains Protein: ENSMUSP00000114203
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
Blast:WD40 172 213 1e-19 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.99e-8 SMART
WD40 344 386 2.84e-4 SMART
WD40 389 429 1.98e1 SMART
WD40 432 471 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150824
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants die embryonically at around E9.5-E12.5 with poorly developed placentae, no placental giant cells and/or erythroblast deficiency. Homozygous MEFs undergo premature senescence. Heterozygotes exhibit learning/memory defects and/or elevatedspontaneous epithelial tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,347,169 E436G probably damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Apob A G 12: 8,011,762 N3415D probably damaging Het
Asb18 T C 1: 89,954,399 E139G probably damaging Het
Atrn T C 2: 131,023,075 L1374P probably damaging Het
Ccdc81 A G 7: 89,877,573 S410P probably damaging Het
Cep112 A G 11: 108,664,605 E809G probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Ddn C A 15: 98,807,003 R82L probably damaging Het
Dgkz A T 2: 91,941,049 probably null Het
Frem1 T C 4: 82,940,753 *415W probably null Het
Fry A T 5: 150,390,667 D789V probably damaging Het
Gemin5 T A 11: 58,130,700 Y1025F probably damaging Het
Gjb5 C T 4: 127,355,554 V266M probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Golgb1 T A 16: 36,928,683 N3056K possibly damaging Het
Gucy1b1 T A 3: 82,039,876 D342V probably damaging Het
Hc A T 2: 35,003,539 probably null Het
Heg1 A G 16: 33,725,434 D185G probably benign Het
Hils1 T C 11: 94,968,017 L46S probably benign Het
Igf2r A T 17: 12,693,145 M1865K possibly damaging Het
Il27 A G 7: 126,592,928 L12P probably damaging Het
Krt1 C T 15: 101,850,714 C5Y unknown Het
Med25 C T 7: 44,885,801 V170M probably damaging Het
Mgat4a T A 1: 37,454,817 Y316F probably damaging Het
Oas3 A G 5: 120,761,644 V725A unknown Het
Olfr1140 T C 2: 87,746,606 S137P probably damaging Het
Olfr655 C A 7: 104,596,725 G152V probably damaging Het
Pcdhb17 T C 18: 37,487,247 S697P probably damaging Het
Plch2 T C 4: 154,991,122 Y751C probably damaging Het
Rbms2 G T 10: 128,137,691 T252N probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scfd1 A G 12: 51,396,739 probably null Het
Shank3 C T 15: 89,548,238 T1062M probably damaging Het
Slc28a1 G A 7: 81,168,039 G552E probably damaging Het
Sntn A G 14: 13,682,214 R96G probably benign Het
Tas2r102 T C 6: 132,763,143 V338A probably benign Het
Trim62 A T 4: 128,885,206 N145Y possibly damaging Het
Tspoap1 C T 11: 87,775,205 T863I possibly damaging Het
Ubr5 C T 15: 38,019,281 C739Y possibly damaging Het
Vps13c G A 9: 67,948,146 V2498I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Fzr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Fzr1 APN 10 81370525 nonsense probably null
IGL02541:Fzr1 APN 10 81370033 missense probably damaging 0.98
IGL03327:Fzr1 APN 10 81369184 missense probably benign 0.05
IGL03346:Fzr1 APN 10 81369184 missense probably benign 0.05
PIT4445001:Fzr1 UTSW 10 81369394 nonsense probably null
R0179:Fzr1 UTSW 10 81369070 splice site probably benign
R0403:Fzr1 UTSW 10 81369368 missense possibly damaging 0.95
R1591:Fzr1 UTSW 10 81370367 missense possibly damaging 0.75
R1987:Fzr1 UTSW 10 81370319 missense probably damaging 0.98
R2358:Fzr1 UTSW 10 81367640 critical splice donor site probably null
R2844:Fzr1 UTSW 10 81369418 missense probably damaging 1.00
R4657:Fzr1 UTSW 10 81367552 critical splice acceptor site probably null
R5054:Fzr1 UTSW 10 81371419 utr 5 prime probably benign
R5108:Fzr1 UTSW 10 81369450 splice site probably benign
R5201:Fzr1 UTSW 10 81367528 missense probably damaging 1.00
R5663:Fzr1 UTSW 10 81370526 missense probably benign 0.00
R5733:Fzr1 UTSW 10 81370326 missense possibly damaging 0.95
R5997:Fzr1 UTSW 10 81370826 critical splice acceptor site probably null
R6777:Fzr1 UTSW 10 81370493 missense probably damaging 1.00
R7055:Fzr1 UTSW 10 81370223 missense probably damaging 1.00
R7078:Fzr1 UTSW 10 81368629 missense probably damaging 1.00
R7883:Fzr1 UTSW 10 81368635 missense probably damaging 1.00
R7966:Fzr1 UTSW 10 81368635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCTGGGTGAAGACACTG -3'
(R):5'- ACCCCTGGAATTGGTGACATC -3'

Sequencing Primer
(F):5'- GACACTGGGGAGTTGGC -3'
(R):5'- AGGTTATCCTTGGCTACACAGAG -3'
Posted On2016-10-05