Incidental Mutation 'R5494:Gemin5'
ID432249
Institutional Source Beutler Lab
Gene Symbol Gemin5
Ensembl Gene ENSMUSG00000037275
Gene Namegem nuclear organelle associated protein 5
Synonyms
MMRRC Submission 043055-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5494 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58120002-58168539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58130700 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1025 (Y1025F)
Ref Sequence ENSEMBL: ENSMUSP00000131842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035604] [ENSMUST00000102711] [ENSMUST00000172035]
Predicted Effect probably damaging
Transcript: ENSMUST00000035604
AA Change: Y1025F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036603
Gene: ENSMUSG00000037275
AA Change: Y1025F

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102711
AA Change: Y1024F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099772
Gene: ENSMUSG00000037275
AA Change: Y1024F

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1063 1083 N/A INTRINSIC
low complexity region 1116 1131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129126
Predicted Effect probably damaging
Transcript: ENSMUST00000172035
AA Change: Y1025F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275
AA Change: Y1025F

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein that is a component of the survival of motor neurons (SMN) complex. The SMN complex plays a critical role in mRNA splicing through the assembly of spliceosomal small nuclear ribonucleoproteins (snRNPs), and may also mediate the assembly and transport of other classes of ribonucleoproteins. The encoded protein is the snRNA-binding component of the SMN complex. Dysregulation of this gene may play a role in alternative mRNA splicing and tumor cell motility. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,347,169 E436G probably damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Apob A G 12: 8,011,762 N3415D probably damaging Het
Asb18 T C 1: 89,954,399 E139G probably damaging Het
Atrn T C 2: 131,023,075 L1374P probably damaging Het
Ccdc81 A G 7: 89,877,573 S410P probably damaging Het
Cep112 A G 11: 108,664,605 E809G probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Ddn C A 15: 98,807,003 R82L probably damaging Het
Dgkz A T 2: 91,941,049 probably null Het
Frem1 T C 4: 82,940,753 *415W probably null Het
Fry A T 5: 150,390,667 D789V probably damaging Het
Fzr1 C T 10: 81,371,344 probably null Het
Gjb5 C T 4: 127,355,554 V266M probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Golgb1 T A 16: 36,928,683 N3056K possibly damaging Het
Gucy1b1 T A 3: 82,039,876 D342V probably damaging Het
Hc A T 2: 35,003,539 probably null Het
Heg1 A G 16: 33,725,434 D185G probably benign Het
Hils1 T C 11: 94,968,017 L46S probably benign Het
Igf2r A T 17: 12,693,145 M1865K possibly damaging Het
Il27 A G 7: 126,592,928 L12P probably damaging Het
Krt1 C T 15: 101,850,714 C5Y unknown Het
Med25 C T 7: 44,885,801 V170M probably damaging Het
Mgat4a T A 1: 37,454,817 Y316F probably damaging Het
Oas3 A G 5: 120,761,644 V725A unknown Het
Olfr1140 T C 2: 87,746,606 S137P probably damaging Het
Olfr655 C A 7: 104,596,725 G152V probably damaging Het
Pcdhb17 T C 18: 37,487,247 S697P probably damaging Het
Plch2 T C 4: 154,991,122 Y751C probably damaging Het
Rbms2 G T 10: 128,137,691 T252N probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scfd1 A G 12: 51,396,739 probably null Het
Shank3 C T 15: 89,548,238 T1062M probably damaging Het
Slc28a1 G A 7: 81,168,039 G552E probably damaging Het
Sntn A G 14: 13,682,214 R96G probably benign Het
Tas2r102 T C 6: 132,763,143 V338A probably benign Het
Trim62 A T 4: 128,885,206 N145Y possibly damaging Het
Tspoap1 C T 11: 87,775,205 T863I possibly damaging Het
Ubr5 C T 15: 38,019,281 C739Y possibly damaging Het
Vps13c G A 9: 67,948,146 V2498I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Gemin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Gemin5 APN 11 58163817 missense probably damaging 1.00
IGL00540:Gemin5 APN 11 58160818 missense probably damaging 1.00
IGL01521:Gemin5 APN 11 58134918 splice site probably benign
IGL02190:Gemin5 APN 11 58134842 missense probably damaging 1.00
IGL02274:Gemin5 APN 11 58156795 missense possibly damaging 0.80
IGL02494:Gemin5 APN 11 58121757 missense probably benign 0.12
IGL02549:Gemin5 APN 11 58134803 missense probably damaging 1.00
IGL02740:Gemin5 APN 11 58151564 missense probably damaging 1.00
IGL02815:Gemin5 APN 11 58146409 missense probably damaging 1.00
IGL02823:Gemin5 APN 11 58167705 splice site probably benign
IGL02939:Gemin5 APN 11 58156730 missense probably damaging 1.00
Landscape UTSW 11 58163904 missense probably benign 0.16
R0101:Gemin5 UTSW 11 58145496 missense probably damaging 1.00
R0479:Gemin5 UTSW 11 58139551 missense probably benign 0.00
R1481:Gemin5 UTSW 11 58141654 missense probably damaging 1.00
R1642:Gemin5 UTSW 11 58139080 missense probably damaging 1.00
R1648:Gemin5 UTSW 11 58147979 nonsense probably null
R1980:Gemin5 UTSW 11 58136917 missense probably damaging 1.00
R3079:Gemin5 UTSW 11 58145519 missense probably damaging 1.00
R3418:Gemin5 UTSW 11 58156628 intron probably null
R4260:Gemin5 UTSW 11 58168359 missense probably damaging 0.99
R4396:Gemin5 UTSW 11 58139549 missense probably benign 0.05
R4902:Gemin5 UTSW 11 58164277 missense probably benign 0.18
R5178:Gemin5 UTSW 11 58146518 missense probably benign 0.01
R5296:Gemin5 UTSW 11 58130061 missense probably damaging 1.00
R5350:Gemin5 UTSW 11 58141586 critical splice donor site probably null
R5426:Gemin5 UTSW 11 58125287 missense probably benign 0.00
R5744:Gemin5 UTSW 11 58155183 missense possibly damaging 0.88
R5889:Gemin5 UTSW 11 58122355 missense possibly damaging 0.76
R5984:Gemin5 UTSW 11 58156761 missense probably damaging 1.00
R6844:Gemin5 UTSW 11 58163904 missense probably benign 0.16
R6934:Gemin5 UTSW 11 58147912 missense probably damaging 1.00
R6999:Gemin5 UTSW 11 58125121 missense probably benign 0.00
R7015:Gemin5 UTSW 11 58156740 missense probably damaging 1.00
R7144:Gemin5 UTSW 11 58141663 missense probably benign 0.30
R7176:Gemin5 UTSW 11 58166002 missense probably benign 0.05
R7540:Gemin5 UTSW 11 58130402 intron probably null
R7670:Gemin5 UTSW 11 58147928 missense probably benign 0.01
R7717:Gemin5 UTSW 11 58151530 critical splice donor site probably null
R7791:Gemin5 UTSW 11 58124993 missense probably benign 0.04
R8050:Gemin5 UTSW 11 58128860 missense probably benign 0.00
X0066:Gemin5 UTSW 11 58151535 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGAGCTTTCCTGAGTGCC -3'
(R):5'- GTGAGACTAATTATTTGGCTGCCTC -3'

Sequencing Primer
(F):5'- CATGCAGGTAGGCTTTGAACC -3'
(R):5'- GACTAATTATTTGGCTGCCTCACTGG -3'
Posted On2016-10-05