Incidental Mutation 'R5495:Sptbn5'
ID432273
Institutional Source Beutler Lab
Gene Symbol Sptbn5
Ensembl Gene ENSMUSG00000074899
Gene Namespectrin beta, non-erythrocytic 5
SynonymsEG640524, Spnb5
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R5495 (G1)
Quality Score143
Status Not validated
Chromosome2
Chromosomal Location120046157-120085772 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 120046484 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126150] [ENSMUST00000129685] [ENSMUST00000156805] [ENSMUST00000162393]
Predicted Effect probably benign
Transcript: ENSMUST00000126150
SMART Domains Protein: ENSMUSP00000118458
Gene: ENSMUSG00000098488

DomainStartEndE-ValueType
C2 19 119 1.79e-17 SMART
PLAc 233 789 1.99e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129685
SMART Domains Protein: ENSMUSP00000115498
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 1012 1.99e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156159
SMART Domains Protein: ENSMUSP00000115974
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
SPEC 60 160 2.54e-6 SMART
SPEC 166 266 1.32e-13 SMART
SPEC 272 372 4.41e-15 SMART
SPEC 378 477 1.56e-15 SMART
SPEC 483 583 1.11e-11 SMART
SPEC 589 689 8.47e-26 SMART
SPEC 695 795 5.56e-12 SMART
SPEC 801 902 7.01e-9 SMART
SPEC 908 1032 4.44e-1 SMART
SPEC 1038 1138 3.73e-13 SMART
Pfam:Spectrin 1141 1206 2.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156805
SMART Domains Protein: ENSMUSP00000117535
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 892 8.56e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162393
SMART Domains Protein: ENSMUSP00000125329
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 242 4.42e-3 SMART
Meta Mutation Damage Score 0.0687 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Sptbn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sptbn5 APN 2 120054467 unclassified probably benign
IGL01552:Sptbn5 APN 2 120054422 unclassified probably benign
IGL01800:Sptbn5 APN 2 120056427 unclassified probably benign
IGL02156:Sptbn5 APN 2 120047617 unclassified probably benign
R0020:Sptbn5 UTSW 2 120065631 missense probably damaging 0.96
R0690:Sptbn5 UTSW 2 120062675 unclassified probably null
R1121:Sptbn5 UTSW 2 120069390 unclassified probably null
R1223:Sptbn5 UTSW 2 120072044 missense probably damaging 0.99
R1405:Sptbn5 UTSW 2 120050616 splice site noncoding transcript
R1852:Sptbn5 UTSW 2 120071644 missense possibly damaging 0.52
R1927:Sptbn5 UTSW 2 120070462 missense probably benign 0.00
R2570:Sptbn5 UTSW 2 120048640 exon noncoding transcript
R3898:Sptbn5 UTSW 2 120057210 exon noncoding transcript
R3976:Sptbn5 UTSW 2 120048261 splice site noncoding transcript
R4092:Sptbn5 UTSW 2 120067051 missense probably damaging 0.99
R4119:Sptbn5 UTSW 2 120064529 missense possibly damaging 0.91
R4120:Sptbn5 UTSW 2 120064529 missense possibly damaging 0.91
R4351:Sptbn5 UTSW 2 120083199 exon noncoding transcript
R4352:Sptbn5 UTSW 2 120083199 exon noncoding transcript
R4364:Sptbn5 UTSW 2 120068655 missense probably damaging 1.00
R4371:Sptbn5 UTSW 2 120065994 missense probably damaging 1.00
R4606:Sptbn5 UTSW 2 120067446 unclassified probably null
R4616:Sptbn5 UTSW 2 120048757 exon noncoding transcript
R4687:Sptbn5 UTSW 2 120077208 unclassified probably benign
R4693:Sptbn5 UTSW 2 120059416 unclassified probably benign
R4762:Sptbn5 UTSW 2 120077222 unclassified noncoding transcript
R4798:Sptbn5 UTSW 2 120059141 unclassified probably benign
R4818:Sptbn5 UTSW 2 120067968 missense probably benign 0.05
R4822:Sptbn5 UTSW 2 120067968 missense probably benign 0.05
R4825:Sptbn5 UTSW 2 120055893 unclassified probably benign
R4933:Sptbn5 UTSW 2 120050120 exon noncoding transcript
R4970:Sptbn5 UTSW 2 120051777 exon noncoding transcript
R5141:Sptbn5 UTSW 2 120061731 missense probably benign 0.03
R5209:Sptbn5 UTSW 2 120072002 missense probably benign 0.09
R5225:Sptbn5 UTSW 2 120085331 unclassified probably benign
R5227:Sptbn5 UTSW 2 120085331 unclassified probably benign
R5421:Sptbn5 UTSW 2 120080780 critical splice donor site noncoding transcript
R5498:Sptbn5 UTSW 2 120076638 unclassified probably benign
R5511:Sptbn5 UTSW 2 120059721 unclassified probably benign
R5596:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5616:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5617:Sptbn5 UTSW 2 120046484 unclassified probably benign
R5619:Sptbn5 UTSW 2 120050132 exon noncoding transcript
R5625:Sptbn5 UTSW 2 120079792 exon noncoding transcript
R5636:Sptbn5 UTSW 2 120057404 unclassified probably benign
R5646:Sptbn5 UTSW 2 120048811 splice site noncoding transcript
R5666:Sptbn5 UTSW 2 120085567 unclassified probably benign
R5670:Sptbn5 UTSW 2 120085567 unclassified probably benign
R5715:Sptbn5 UTSW 2 120072504 missense probably damaging 1.00
R5774:Sptbn5 UTSW 2 120050458 exon noncoding transcript
R5885:Sptbn5 UTSW 2 120076663 unclassified probably benign
R6016:Sptbn5 UTSW 2 120050092 exon noncoding transcript
R6183:Sptbn5 UTSW 2 120059417 unclassified probably benign
R6184:Sptbn5 UTSW 2 120059417 unclassified probably benign
R6219:Sptbn5 UTSW 2 120077322 unclassified probably benign
R6335:Sptbn5 UTSW 2 120054419 unclassified probably benign
R6383:Sptbn5 UTSW 2 120046269 unclassified probably benign
R6450:Sptbn5 UTSW 2 120047135 unclassified probably benign
R6516:Sptbn5 UTSW 2 120047950 unclassified probably benign
R6523:Sptbn5 UTSW 2 120065614 unclassified probably null
R6657:Sptbn5 UTSW 2 120076400 unclassified probably benign
R6661:Sptbn5 UTSW 2 120072375 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTTCCACTTCCAACACCGAGTG -3'
(R):5'- TTCCTGTCCCCAGAGGTTTG -3'

Sequencing Primer
(F):5'- TTCCAACACCGAGTGCTGAGAG -3'
(R):5'- TCCCCAGAGGTTTGAGCAGAG -3'
Posted On2016-10-05