Incidental Mutation 'R5495:Larp1b'
ID432277
Institutional Source Beutler Lab
Gene Symbol Larp1b
Ensembl Gene ENSMUSG00000025762
Gene NameLa ribonucleoprotein domain family, member 1B
SynonymsLarp2, 1700108L22Rik, 4933421B21Rik
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location40950354-41040234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41035822 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Isoleucine at position 135 (R135I)
Ref Sequence ENSEMBL: ENSMUSP00000096721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026862] [ENSMUST00000099121]
Predicted Effect probably benign
Transcript: ENSMUST00000026862
SMART Domains Protein: ENSMUSP00000026862
Gene: ENSMUSG00000025762

DomainStartEndE-ValueType
low complexity region 75 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065411
SMART Domains Protein: ENSMUSP00000066664
Gene: ENSMUSG00000025762

DomainStartEndE-ValueType
Blast:DM15 31 65 1e-16 BLAST
low complexity region 119 129 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099121
AA Change: R135I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096721
Gene: ENSMUSG00000025762
AA Change: R135I

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
DM15 52 93 6.61e-18 SMART
DM15 94 132 5.75e-18 SMART
DM15 133 167 2.82e-1 SMART
low complexity region 221 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199797
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Larp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Larp1b APN 3 41033440 nonsense probably null
IGL01636:Larp1b APN 3 40970478 missense probably benign 0.35
IGL01845:Larp1b APN 3 40970525 missense probably benign 0.03
IGL02192:Larp1b APN 3 40967494 missense probably benign 0.01
IGL03372:Larp1b APN 3 41024527 missense possibly damaging 0.79
R0396:Larp1b UTSW 3 40970561 missense probably damaging 1.00
R0512:Larp1b UTSW 3 40970034 missense probably benign 0.00
R0975:Larp1b UTSW 3 40970490 missense probably damaging 0.99
R1119:Larp1b UTSW 3 41033528 missense possibly damaging 0.87
R1337:Larp1b UTSW 3 41033402 missense probably damaging 1.00
R1460:Larp1b UTSW 3 40962218 missense probably benign
R1565:Larp1b UTSW 3 40972384 missense probably damaging 1.00
R1589:Larp1b UTSW 3 41033474 missense probably damaging 1.00
R1640:Larp1b UTSW 3 41034072 start codon destroyed probably null 0.04
R1899:Larp1b UTSW 3 40964084 missense probably benign 0.04
R2133:Larp1b UTSW 3 40970535 missense possibly damaging 0.69
R3054:Larp1b UTSW 3 40964100 missense probably benign 0.10
R4621:Larp1b UTSW 3 40963989 missense possibly damaging 0.71
R4818:Larp1b UTSW 3 40970570 missense probably damaging 1.00
R5023:Larp1b UTSW 3 41033985 missense possibly damaging 0.88
R5166:Larp1b UTSW 3 40964052 nonsense probably null
R5357:Larp1b UTSW 3 41024515 missense probably benign 0.04
R5364:Larp1b UTSW 3 40977223 missense probably damaging 0.99
R5492:Larp1b UTSW 3 40969899 missense probably damaging 0.99
R7070:Larp1b UTSW 3 40976651 missense probably damaging 1.00
R7293:Larp1b UTSW 3 40985444 missense
R7615:Larp1b UTSW 3 41033534 missense possibly damaging 0.79
R7615:Larp1b UTSW 3 41035816 missense probably benign 0.01
R7717:Larp1b UTSW 3 40972444 missense probably damaging 0.97
R8060:Larp1b UTSW 3 40985402 missense
X0021:Larp1b UTSW 3 40967494 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATGGTGTCCCTGAATCTTTTCAC -3'
(R):5'- TTCGCTGCATGGTAGCTACC -3'

Sequencing Primer
(F):5'- CATCATTCATGAAGCTGAGGC -3'
(R):5'- GAAGGTTCTTTCCAAAGCAGGTTCC -3'
Posted On2016-10-05