Incidental Mutation 'R5495:Lrat'
ID432278
Institutional Source Beutler Lab
Gene Symbol Lrat
Ensembl Gene ENSMUSG00000028003
Gene Namelecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase)
Synonyms
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location82892579-82903973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 82896982 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 229 (M229I)
Ref Sequence ENSEMBL: ENSMUSP00000029632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029632]
PDB Structure
Crystal structure of HRASLS3/LRAT chimeric protein [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000029632
AA Change: M229I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029632
Gene: ENSMUSG00000028003
AA Change: M229I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:LRAT 43 174 1.4e-44 PFAM
low complexity region 194 205 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156457
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit retinol homeostasis abnormalities and are more susceptible to vitamin A deficiency or display impaired vision associated with abnormal retinol metabolism. Males have testicular hypoplasia/atrophy and reduced mature sperm counts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Lrat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03206:Lrat APN 3 82903349 missense probably damaging 0.99
R1445:Lrat UTSW 3 82903369 missense probably damaging 1.00
R1491:Lrat UTSW 3 82903342 missense probably benign 0.07
R1735:Lrat UTSW 3 82897110 missense probably benign 0.01
R2419:Lrat UTSW 3 82903685 missense probably damaging 1.00
R4446:Lrat UTSW 3 82896986 missense probably damaging 0.98
R5442:Lrat UTSW 3 82903220 missense probably damaging 1.00
R6255:Lrat UTSW 3 82903505 missense probably damaging 1.00
R6468:Lrat UTSW 3 82903492 missense probably damaging 1.00
R6909:Lrat UTSW 3 82903654 missense probably damaging 1.00
R7041:Lrat UTSW 3 82903448 missense probably benign 0.03
R7396:Lrat UTSW 3 82903283 nonsense probably null
Z1177:Lrat UTSW 3 82903490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCACGTGGTATGATTC -3'
(R):5'- CGGGAAGACTACTTGGTCTGTG -3'

Sequencing Primer
(F):5'- GCAAGCACGTGGTATGATTCTTAATC -3'
(R):5'- AGCCATGGTTCCTAACAGTC -3'
Posted On2016-10-05