Incidental Mutation 'R5495:9130204L05Rik'
ID432279
Institutional Source Beutler Lab
Gene Symbol 9130204L05Rik
Ensembl Gene ENSMUSG00000091175
Gene NameRIKEN cDNA 9130204L05 gene
SynonymsLOC229550
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location91088137-91090803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91090295 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 38 (L38M)
Ref Sequence ENSEMBL: ENSMUSP00000130512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166173]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166173
AA Change: L38M

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130512
Gene: ENSMUSG00000091175
AA Change: L38M

DomainStartEndE-ValueType
Pfam:S_100 9 48 4.4e-10 PFAM
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in 9130204L05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:9130204L05Rik APN 3 91088358 missense probably benign 0.01
IGL01372:9130204L05Rik APN 3 91088309 utr 3 prime probably benign
IGL01526:9130204L05Rik APN 3 91088305 utr 3 prime probably benign
IGL02894:9130204L05Rik APN 3 91088393 missense probably benign 0.18
IGL03110:9130204L05Rik APN 3 91088319 missense unknown
IGL03250:9130204L05Rik APN 3 91090408 utr 5 prime probably benign
R2357:9130204L05Rik UTSW 3 91088426 missense probably benign 0.35
R3795:9130204L05Rik UTSW 3 91088423 missense possibly damaging 0.73
R5315:9130204L05Rik UTSW 3 91090330 missense possibly damaging 0.56
R6314:9130204L05Rik UTSW 3 91088376 missense possibly damaging 0.56
Z1177:9130204L05Rik UTSW 3 91088356 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGTGAACAACTCTATACCACTG -3'
(R):5'- TGCTCCTTTCCAGAGAACAGG -3'

Sequencing Primer
(F):5'- CTGTCTAGAACATGGGATCTCAC -3'
(R):5'- TCCTTTCCAGAGAACAGGTCAAGG -3'
Posted On2016-10-05