Incidental Mutation 'R5495:Atp1a1'
ID432281
Institutional Source Beutler Lab
Gene Symbol Atp1a1
Ensembl Gene ENSMUSG00000033161
Gene NameATPase, Na+/K+ transporting, alpha 1 polypeptide
SynonymsAtpa-1
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location101576219-101604684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101591425 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 184 (D184A)
Ref Sequence ENSEMBL: ENSMUSP00000039657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036493]
Predicted Effect probably benign
Transcript: ENSMUST00000036493
AA Change: D184A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: D184A

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
Cation_ATPase_N 42 116 5e-20 SMART
Pfam:E1-E2_ATPase 134 365 1.6e-59 PFAM
Pfam:Hydrolase 370 729 2.7e-19 PFAM
Pfam:HAD 373 726 1.3e-18 PFAM
Pfam:Cation_ATPase 426 521 2.2e-25 PFAM
Pfam:Cation_ATPase_C 799 1008 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200347
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Atp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Atp1a1 APN 3 101591453 missense probably damaging 1.00
IGL01700:Atp1a1 APN 3 101594258 missense possibly damaging 0.95
IGL01836:Atp1a1 APN 3 101591414 missense probably damaging 1.00
IGL01863:Atp1a1 APN 3 101591889 nonsense probably null
IGL02021:Atp1a1 APN 3 101594208 missense probably benign 0.02
IGL02078:Atp1a1 APN 3 101591863 missense probably damaging 1.00
IGL02873:Atp1a1 APN 3 101576578 missense probably benign 0.16
IGL02934:Atp1a1 APN 3 101576992 nonsense probably null
IGL03068:Atp1a1 APN 3 101583859 missense probably benign 0.26
PIT4453001:Atp1a1 UTSW 3 101581179 missense probably benign 0.01
R0009:Atp1a1 UTSW 3 101579835 missense possibly damaging 0.67
R0506:Atp1a1 UTSW 3 101589812 missense probably damaging 0.96
R0724:Atp1a1 UTSW 3 101592439 missense possibly damaging 0.50
R0826:Atp1a1 UTSW 3 101584853 missense probably damaging 0.99
R1457:Atp1a1 UTSW 3 101590466 missense probably damaging 1.00
R1732:Atp1a1 UTSW 3 101584799 missense probably damaging 1.00
R1843:Atp1a1 UTSW 3 101582017 missense probably benign 0.43
R2172:Atp1a1 UTSW 3 101590548 missense probably benign
R3770:Atp1a1 UTSW 3 101581194 missense probably benign 0.17
R3905:Atp1a1 UTSW 3 101590612 missense probably benign 0.00
R4602:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4611:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4715:Atp1a1 UTSW 3 101591806 missense possibly damaging 0.90
R4777:Atp1a1 UTSW 3 101594996 critical splice donor site probably null
R4795:Atp1a1 UTSW 3 101583775 missense probably benign 0.15
R5030:Atp1a1 UTSW 3 101579817 missense probably benign 0.22
R5066:Atp1a1 UTSW 3 101582104 missense probably damaging 0.98
R5165:Atp1a1 UTSW 3 101581789 missense probably benign 0.01
R5297:Atp1a1 UTSW 3 101591127 missense possibly damaging 0.82
R5307:Atp1a1 UTSW 3 101589964 missense probably damaging 1.00
R5379:Atp1a1 UTSW 3 101582095 missense probably benign 0.01
R5946:Atp1a1 UTSW 3 101589774 missense probably benign 0.12
R6125:Atp1a1 UTSW 3 101590707 missense probably damaging 1.00
R6789:Atp1a1 UTSW 3 101586298 missense possibly damaging 0.71
R7339:Atp1a1 UTSW 3 101589872 missense probably benign 0.44
R7552:Atp1a1 UTSW 3 101582121 nonsense probably null
R7825:Atp1a1 UTSW 3 101586169 missense probably benign 0.00
R8098:Atp1a1 UTSW 3 101582049 missense probably damaging 0.97
R8175:Atp1a1 UTSW 3 101584854 missense possibly damaging 0.79
X0019:Atp1a1 UTSW 3 101594213 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGGGGTTCTGATTCACCAG -3'
(R):5'- ATCTTTGCTGTGGACCCAGG -3'

Sequencing Primer
(F):5'- ATTCACCAGTGAGTGAGGAGTTATCC -3'
(R):5'- CCAGGTAATTTGGGATACACGC -3'
Posted On2016-10-05