Mutagenetix > Incidental Mutation

Incidental Mutation 'R5495:Atp1a1'

432281

Institutional Source

Beutler Lab

Gene Symbol

Atp1a1

Ensembl Gene

ENSMUSG00000033161

Gene Name

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Synonyms

Atpa-1

MMRRC Submission

043056-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5495 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101576219-101604684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 101591425 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 184 (D184A)

Ref Sequence

ENSEMBL: ENSMUSP00000039657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036493]

AlphaFold

Q8VDN2

Predicted Effect

probably benign
Transcript: ENSMUST00000036493
AA Change: D184A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: D184A

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
Cation_ATPase_N	42	116	5e-20	SMART
Pfam:E1-E2_ATPase	134	365	1.6e-59	PFAM
Pfam:Hydrolase	370	729	2.7e-19	PFAM
Pfam:HAD	373	726	1.3e-18	PFAM
Pfam:Cation_ATPase	426	521	2.2e-25	PFAM
Pfam:Cation_ATPase_C	799	1008	1.2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136340

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200347

Coding Region Coverage

1x: 98.4%
3x: 97.3%
10x: 95.3%
20x: 91.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130204L05Rik	A	T	3: 91,090,295	L38M	possibly damaging	Het
Akt2	T	C	7: 27,636,169		probably null	Het
Arhgap29	T	G	3: 122,014,929	M844R	probably damaging	Het
Bcl11a	T	A	11: 24,165,042	V795E	possibly damaging	Het
Casp12	T	A	9: 5,353,797	I277N	possibly damaging	Het
Ccdc59	A	G	10: 105,845,378	K164E	probably damaging	Het
D630003M21Rik	C	T	2: 158,220,511	G30S	possibly damaging	Het
Dgkd	A	G	1: 87,926,872	D632G	probably damaging	Het
Efr3a	A	G	15: 65,815,409	K56E	possibly damaging	Het
Egflam	T	A	15: 7,251,241	R434S	probably damaging	Het
Fancl	C	G	11: 26,397,801	A51G	probably damaging	Het
Fkbp7	T	C	2: 76,663,294	Y185C	probably damaging	Het
Galc	A	G	12: 98,231,414		probably null	Het
Galnt15	A	G	14: 32,029,817	S109G	probably damaging	Het
Gm13757	T	C	2: 88,446,057	T294A	probably benign	Het
Gramd3	T	C	18: 56,482,622	I163T	probably damaging	Het
Impa1	A	G	3: 10,326,170	V80A	probably benign	Het
Itga10	T	C	3: 96,647,371	M56T	possibly damaging	Het
Larp1b	G	T	3: 41,035,822	R135I	probably damaging	Het
Lgals12	C	T	19: 7,604,130	A71T	probably damaging	Het
Lmbr1	A	T	5: 29,346,853	L78*	probably null	Het
Lrat	C	A	3: 82,896,982	M229I	probably benign	Het
Mug2	A	T	6: 122,079,650	M1185L	probably damaging	Het
Naprt	T	C	15: 75,893,847		probably null	Het
Nfat5	A	G	8: 107,368,447	I1107V	probably benign	Het
Nr4a2	T	C	2: 57,112,375	Y22C	probably damaging	Het
Ogfod1	C	A	8: 94,064,278	Q526K	probably benign	Het
Olfr139	G	A	11: 74,044,785	T163I	probably damaging	Het
Olfr710	C	A	7: 106,944,492	G170*	probably null	Het
Olfr957	T	C	9: 39,511,145	T192A	probably benign	Het
Parp10	T	G	15: 76,243,166	I24L	probably benign	Het
Pcdha11	A	G	18: 37,011,026	T57A	probably benign	Het
Prdm8	A	G	5: 98,185,306	E244G	possibly damaging	Het
Prl6a1	T	C	13: 27,312,671	S3P	possibly damaging	Het
Rab11fip3	T	A	17: 26,016,143	T18S	probably damaging	Het
Rfc4	T	C	16: 23,122,254		probably benign	Het
Rubcnl	G	T	14: 75,042,337	V387F	possibly damaging	Het
Serpinb12	T	C	1: 106,956,421	L299P	probably damaging	Het
Sptbn5	G	A	2: 120,046,484		probably benign	Het
Taar4	A	T	10: 23,961,283	I264F	possibly damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Thsd7b	T	A	1: 129,595,833	H124Q	probably damaging	Het
Ugt1a6a	A	T	1: 88,139,024	Q184L	probably benign	Het
Vnn1	T	A	10: 23,898,564	F168L	probably damaging	Het
Zan	A	G	5: 137,470,408	L267P	probably damaging	Het
Zswim8	A	G	14: 20,722,286	S1621G	probably damaging	Het

Other mutations in Atp1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Atp1a1	APN	3	101591453	missense	probably damaging	1.00
IGL01700:Atp1a1	APN	3	101594258	missense	possibly damaging	0.95
IGL01836:Atp1a1	APN	3	101591414	missense	probably damaging	1.00
IGL01863:Atp1a1	APN	3	101591889	nonsense	probably null
IGL02021:Atp1a1	APN	3	101594208	missense	probably benign	0.02
IGL02078:Atp1a1	APN	3	101591863	missense	probably damaging	1.00
IGL02873:Atp1a1	APN	3	101576578	missense	probably benign	0.16
IGL02934:Atp1a1	APN	3	101576992	nonsense	probably null
IGL03068:Atp1a1	APN	3	101583859	missense	probably benign	0.26
PIT4453001:Atp1a1	UTSW	3	101581179	missense	probably benign	0.01
R0009:Atp1a1	UTSW	3	101579835	missense	possibly damaging	0.67
R0506:Atp1a1	UTSW	3	101589812	missense	probably damaging	0.96
R0724:Atp1a1	UTSW	3	101592439	missense	possibly damaging	0.50
R0826:Atp1a1	UTSW	3	101584853	missense	probably damaging	0.99
R1457:Atp1a1	UTSW	3	101590466	missense	probably damaging	1.00
R1732:Atp1a1	UTSW	3	101584799	missense	probably damaging	1.00
R1843:Atp1a1	UTSW	3	101582017	missense	probably benign	0.43
R2172:Atp1a1	UTSW	3	101590548	missense	probably benign
R3770:Atp1a1	UTSW	3	101581194	missense	probably benign	0.17
R3905:Atp1a1	UTSW	3	101590612	missense	probably benign	0.00
R4602:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4611:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4715:Atp1a1	UTSW	3	101591806	missense	possibly damaging	0.90
R4777:Atp1a1	UTSW	3	101594996	critical splice donor site	probably null
R4795:Atp1a1	UTSW	3	101583775	missense	probably benign	0.15
R5030:Atp1a1	UTSW	3	101579817	missense	probably benign	0.22
R5066:Atp1a1	UTSW	3	101582104	missense	probably damaging	0.98
R5165:Atp1a1	UTSW	3	101581789	missense	probably benign	0.01
R5297:Atp1a1	UTSW	3	101591127	missense	possibly damaging	0.82
R5307:Atp1a1	UTSW	3	101589964	missense	probably damaging	1.00
R5379:Atp1a1	UTSW	3	101582095	missense	probably benign	0.01
R5946:Atp1a1	UTSW	3	101589774	missense	probably benign	0.12
R6125:Atp1a1	UTSW	3	101590707	missense	probably damaging	1.00
R6789:Atp1a1	UTSW	3	101586298	missense	possibly damaging	0.71
R7339:Atp1a1	UTSW	3	101589872	missense	probably benign	0.44
R7552:Atp1a1	UTSW	3	101582121	nonsense	probably null
R7825:Atp1a1	UTSW	3	101586169	missense	probably benign	0.00
R8098:Atp1a1	UTSW	3	101582049	missense	probably damaging	0.97
R8175:Atp1a1	UTSW	3	101584854	missense	possibly damaging	0.79
R8281:Atp1a1	UTSW	3	101579624	missense	probably benign	0.12
R8403:Atp1a1	UTSW	3	101586904	missense	probably damaging	1.00
R8435:Atp1a1	UTSW	3	101582762	missense	probably benign
R8461:Atp1a1	UTSW	3	101589089	missense	probably benign	0.01
R8772:Atp1a1	UTSW	3	101579808	missense	probably benign
R8782:Atp1a1	UTSW	3	101594217	missense	possibly damaging	0.63
R8919:Atp1a1	UTSW	3	101591231	missense	probably damaging	1.00
R9066:Atp1a1	UTSW	3	101582022	missense	probably damaging	1.00
R9227:Atp1a1	UTSW	3	101592434	missense	probably damaging	1.00
R9712:Atp1a1	UTSW	3	101591441	missense	probably benign	0.06
X0019:Atp1a1	UTSW	3	101594213	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGGGGTTCTGATTCACCAG -3'
(R):5'- ATCTTTGCTGTGGACCCAGG -3'

Sequencing Primer
(F):5'- ATTCACCAGTGAGTGAGGAGTTATCC -3'
(R):5'- CCAGGTAATTTGGGATACACGC -3'

Posted On

2016-10-05