Mutagenetix > Incidental Mutations

Incidental Mutation 'R5495:Arhgap29'

432282

Institutional Source

Beutler Lab

Gene Symbol

Arhgap29

Ensembl Gene

ENSMUSG00000039831

Gene Name

Rho GTPase activating protein 29

Synonyms

B130017I01Rik, 6720461J18Rik, C76601, Parg1

MMRRC Submission

043056-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5495 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121952541-122016753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 122014929 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 844 (M844R)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037958]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037958
AA Change: M1252R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: M1252R

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	5e-41	PDB
Blast:RhoGAP	412	595	9e-84	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	885	1.92e-68	SMART
low complexity region	947	961	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000198914
AA Change: M844R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 98.4%
3x: 97.3%
10x: 95.3%
20x: 91.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130204L05Rik	A	T	3: 91,090,295	L38M	possibly damaging	Het
Akt2	T	C	7: 27,636,169		probably null	Het
Atp1a1	T	G	3: 101,591,425	D184A	probably benign	Het
Bcl11a	T	A	11: 24,165,042	V795E	possibly damaging	Het
Casp12	T	A	9: 5,353,797	I277N	possibly damaging	Het
Ccdc59	A	G	10: 105,845,378	K164E	probably damaging	Het
D630003M21Rik	C	T	2: 158,220,511	G30S	possibly damaging	Het
Dgkd	A	G	1: 87,926,872	D632G	probably damaging	Het
Efr3a	A	G	15: 65,815,409	K56E	possibly damaging	Het
Egflam	T	A	15: 7,251,241	R434S	probably damaging	Het
Fancl	C	G	11: 26,397,801	A51G	probably damaging	Het
Fkbp7	T	C	2: 76,663,294	Y185C	probably damaging	Het
Galc	A	G	12: 98,231,414		probably null	Het
Galnt15	A	G	14: 32,029,817	S109G	probably damaging	Het
Gm13757	T	C	2: 88,446,057	T294A	probably benign	Het
Gramd3	T	C	18: 56,482,622	I163T	probably damaging	Het
Impa1	A	G	3: 10,326,170	V80A	probably benign	Het
Itga10	T	C	3: 96,647,371	M56T	possibly damaging	Het
Larp1b	G	T	3: 41,035,822	R135I	probably damaging	Het
Lgals12	C	T	19: 7,604,130	A71T	probably damaging	Het
Lmbr1	A	T	5: 29,346,853	L78*	probably null	Het
Lrat	C	A	3: 82,896,982	M229I	probably benign	Het
Mug2	A	T	6: 122,079,650	M1185L	probably damaging	Het
Naprt	T	C	15: 75,893,847		probably null	Het
Nfat5	A	G	8: 107,368,447	I1107V	probably benign	Het
Nr4a2	T	C	2: 57,112,375	Y22C	probably damaging	Het
Ogfod1	C	A	8: 94,064,278	Q526K	probably benign	Het
Olfr139	G	A	11: 74,044,785	T163I	probably damaging	Het
Olfr710	C	A	7: 106,944,492	G170*	probably null	Het
Olfr957	T	C	9: 39,511,145	T192A	probably benign	Het
Parp10	T	G	15: 76,243,166	I24L	probably benign	Het
Pcdha11	A	G	18: 37,011,026	T57A	probably benign	Het
Prdm8	A	G	5: 98,185,306	E244G	possibly damaging	Het
Prl6a1	T	C	13: 27,312,671	S3P	possibly damaging	Het
Rab11fip3	T	A	17: 26,016,143	T18S	probably damaging	Het
Rfc4	T	C	16: 23,122,254		probably benign	Het
Rubcnl	G	T	14: 75,042,337	V387F	possibly damaging	Het
Serpinb12	T	C	1: 106,956,421	L299P	probably damaging	Het
Sptbn5	G	A	2: 120,046,484		probably benign	Het
Taar4	A	T	10: 23,961,283	I264F	possibly damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Thsd7b	T	A	1: 129,595,833	H124Q	probably damaging	Het
Ugt1a6a	A	T	1: 88,139,024	Q184L	probably benign	Het
Vnn1	T	A	10: 23,898,564	F168L	probably damaging	Het
Zan	A	G	5: 137,470,408	L267P	probably damaging	Het
Zswim8	A	G	14: 20,722,286	S1621G	probably damaging	Het

Other mutations in Arhgap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Arhgap29	APN	3	122003312	nonsense	probably null
IGL01121:Arhgap29	APN	3	122009863	missense	probably damaging	1.00
IGL01622:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01623:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01995:Arhgap29	APN	3	122014328	missense	probably benign	0.00
IGL02120:Arhgap29	APN	3	122004257	missense	probably benign	0.05
IGL02554:Arhgap29	APN	3	121992524	unclassified	probably benign
IGL02931:Arhgap29	APN	3	121992860	missense	probably benign
IGL02937:Arhgap29	APN	3	121974049	missense	probably damaging	0.99
PIT4362001:Arhgap29	UTSW	3	122003212	missense	probably benign	0.42
R0022:Arhgap29	UTSW	3	121988937	missense	possibly damaging	0.61
R0574:Arhgap29	UTSW	3	122007625	missense	probably benign	0.01
R0601:Arhgap29	UTSW	3	121991110	missense	probably damaging	1.00
R0639:Arhgap29	UTSW	3	122007641	missense	probably damaging	1.00
R0881:Arhgap29	UTSW	3	122014679	missense	probably damaging	1.00
R1232:Arhgap29	UTSW	3	122003340	missense	probably damaging	1.00
R1295:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1296:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1470:Arhgap29	UTSW	3	121992319	unclassified	probably benign
R1710:Arhgap29	UTSW	3	122008080	missense	probably damaging	1.00
R1878:Arhgap29	UTSW	3	122011371	missense	probably damaging	1.00
R2051:Arhgap29	UTSW	3	121981860	missense	probably benign	0.01
R2112:Arhgap29	UTSW	3	122011561	missense	probably benign	0.03
R2188:Arhgap29	UTSW	3	121991009	missense	probably damaging	1.00
R2240:Arhgap29	UTSW	3	122011453	missense	probably benign	0.12
R2420:Arhgap29	UTSW	3	121973980	missense	probably benign
R3618:Arhgap29	UTSW	3	121988527	missense	possibly damaging	0.62
R4673:Arhgap29	UTSW	3	122014971	missense	probably damaging	1.00
R4717:Arhgap29	UTSW	3	122009958	missense	possibly damaging	0.82
R5028:Arhgap29	UTSW	3	122010060	critical splice donor site	probably null
R5043:Arhgap29	UTSW	3	121974004	missense	probably benign	0.00
R5045:Arhgap29	UTSW	3	122002595	missense	probably benign	0.28
R5463:Arhgap29	UTSW	3	121988551	missense	possibly damaging	0.94
R5743:Arhgap29	UTSW	3	121981911	missense	probably damaging	1.00
R5791:Arhgap29	UTSW	3	122014245	missense	probably damaging	0.98
R5896:Arhgap29	UTSW	3	122012087	missense	possibly damaging	0.78
R6083:Arhgap29	UTSW	3	121992748	missense	probably benign	0.00
R6355:Arhgap29	UTSW	3	122011258	missense	possibly damaging	0.46
R6451:Arhgap29	UTSW	3	121993581	missense	probably damaging	1.00
R6528:Arhgap29	UTSW	3	122014702	missense	probably benign	0.13
R7239:Arhgap29	UTSW	3	121988950	missense	probably benign	0.16
R7669:Arhgap29	UTSW	3	121992812	missense	probably damaging	1.00
R7807:Arhgap29	UTSW	3	122014332	missense	probably benign	0.01
R8048:Arhgap29	UTSW	3	121992901	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATTACCCTCAATAGCTGTACC -3'
(R):5'- TAAACGGAGCCTTGTCAGGAC -3'

Sequencing Primer
(F):5'- AATAGCTGTACCTCCTGTCCTGG -3'
(R):5'- GAGCCTTGTCAGGACACTCTC -3'

Posted On

2016-10-05