Incidental Mutation 'R5495:Lmbr1'
ID432283
Institutional Source Beutler Lab
Gene Symbol Lmbr1
Ensembl Gene ENSMUSG00000010721
Gene Namelimb region 1
Synonyms1110048D14Rik
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location29229802-29378390 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 29346853 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 78 (L78*)
Ref Sequence ENSEMBL: ENSMUSP00000142755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055195] [ENSMUST00000179191] [ENSMUST00000196321] [ENSMUST00000198105] [ENSMUST00000200564]
Predicted Effect probably null
Transcript: ENSMUST00000055195
AA Change: L78*
SMART Domains Protein: ENSMUSP00000058405
Gene: ENSMUSG00000010721
AA Change: L78*

DomainStartEndE-ValueType
Pfam:LMBR1 26 281 3.5e-46 PFAM
Pfam:LMBR1 239 445 1.7e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179191
AA Change: L78*
SMART Domains Protein: ENSMUSP00000136160
Gene: ENSMUSG00000010721
AA Change: L78*

DomainStartEndE-ValueType
Pfam:LMBR1 23 108 6e-31 PFAM
Pfam:LMBR1 106 418 5.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196321
SMART Domains Protein: ENSMUSP00000143348
Gene: ENSMUSG00000010721

DomainStartEndE-ValueType
Pfam:LMBR1 1 323 4e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198105
AA Change: L78*
SMART Domains Protein: ENSMUSP00000142755
Gene: ENSMUSG00000010721
AA Change: L78*

DomainStartEndE-ValueType
Pfam:LMBR1 23 107 5.4e-30 PFAM
Pfam:LMBR1 106 419 3.4e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198367
Predicted Effect probably benign
Transcript: ENSMUST00000200564
SMART Domains Protein: ENSMUSP00000143316
Gene: ENSMUSG00000010721

DomainStartEndE-ValueType
Pfam:LMBR1 1 310 8.6e-92 PFAM
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the LMBR1-like membrane protein family. Another member of this protein family has been shown to be a lipocalin transmembrane receptor. A highly conserved, cis-acting regulatory module for the sonic hedgehog gene is located within an intron of this gene. Consequently, disruption of this genic region can alter sonic hedgehog expression and affect limb patterning, but it is not known if this gene functions directly in limb development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show minor coalitions of distal wrist bones and a low incidence of limb defects, including oligodactyly, brachyphalangia, and soft tissue or bony syndactyly. Homozygotes for another null allele exhibit normal morphology,clinical chemistry, hematology and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Lmbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Lmbr1 APN 5 29235055 missense probably damaging 1.00
IGL02285:Lmbr1 APN 5 29254235 splice site probably benign
IGL02793:Lmbr1 APN 5 29292188 missense probably damaging 1.00
IGL02875:Lmbr1 APN 5 29292188 missense probably damaging 1.00
IGL03103:Lmbr1 APN 5 29235016 missense probably damaging 0.99
IGL02988:Lmbr1 UTSW 5 29292223 splice site probably null
R0255:Lmbr1 UTSW 5 29252755 missense probably damaging 1.00
R0594:Lmbr1 UTSW 5 29292209 missense possibly damaging 0.87
R0993:Lmbr1 UTSW 5 29287393 missense probably damaging 1.00
R1036:Lmbr1 UTSW 5 29258747 missense probably damaging 1.00
R1570:Lmbr1 UTSW 5 29254558 missense probably damaging 1.00
R1724:Lmbr1 UTSW 5 29361083 missense probably benign 0.03
R2056:Lmbr1 UTSW 5 29233094 missense probably benign 0.07
R2996:Lmbr1 UTSW 5 29363933 missense probably benign 0.29
R4082:Lmbr1 UTSW 5 29258755 missense probably damaging 1.00
R4618:Lmbr1 UTSW 5 29346865 missense probably damaging 1.00
R4842:Lmbr1 UTSW 5 29287426 missense probably damaging 0.97
R4857:Lmbr1 UTSW 5 29323809 missense probably damaging 0.98
R5647:Lmbr1 UTSW 5 29263393 critical splice donor site probably null
R6393:Lmbr1 UTSW 5 29254294 missense probably damaging 1.00
R6466:Lmbr1 UTSW 5 29378168 missense probably benign 0.05
R6486:Lmbr1 UTSW 5 29323861 missense probably damaging 0.99
R6576:Lmbr1 UTSW 5 29291310 missense probably damaging 1.00
R6874:Lmbr1 UTSW 5 29292906 missense probably damaging 1.00
R7085:Lmbr1 UTSW 5 29361092 splice site probably null
R7484:Lmbr1 UTSW 5 29346852 start gained probably benign
R7487:Lmbr1 UTSW 5 29254264 missense probably benign 0.38
Z1088:Lmbr1 UTSW 5 29323816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTGAAGGAAACTAAGAAAACCC -3'
(R):5'- CTGTGCAGCACTCTCTTAAGTATATAG -3'

Sequencing Primer
(F):5'- GAAAACCCTATAACTTACACAGCAG -3'
(R):5'- GCCACTTTTTAGGAATTTGGCC -3'
Posted On2016-10-05