Incidental Mutation 'R5495:Olfr710'
ID432291
Institutional Source Beutler Lab
Gene Symbol Olfr710
Ensembl Gene ENSMUSG00000045581
Gene Nameolfactory receptor 710
SynonymsGA_x6K02T2PBJ9-9325348-9324416, MOR260-3
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106943911-106948312 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 106944492 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 170 (G170*)
Ref Sequence ENSEMBL: ENSMUSP00000062956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055923]
Predicted Effect probably null
Transcript: ENSMUST00000055923
AA Change: G170*
SMART Domains Protein: ENSMUSP00000062956
Gene: ENSMUSG00000045581
AA Change: G170*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-9 PFAM
Pfam:7tm_1 41 290 1.2e-23 PFAM
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Olfr710
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Olfr710 APN 7 106944541 missense possibly damaging 0.77
IGL01534:Olfr710 APN 7 106944339 missense probably damaging 1.00
IGL02041:Olfr710 APN 7 106944113 missense possibly damaging 0.78
IGL02414:Olfr710 APN 7 106944758 missense probably benign 0.33
IGL02695:Olfr710 APN 7 106944663 missense possibly damaging 0.93
IGL03167:Olfr710 APN 7 106944645 missense probably damaging 0.99
IGL03242:Olfr710 APN 7 106944918 missense possibly damaging 0.59
R1985:Olfr710 UTSW 7 106944926 missense probably benign 0.00
R2234:Olfr710 UTSW 7 106944620 missense probably damaging 1.00
R3414:Olfr710 UTSW 7 106944176 nonsense probably null
R3731:Olfr710 UTSW 7 106944477 missense probably damaging 0.99
R3777:Olfr710 UTSW 7 106944312 missense probably benign 0.05
R4646:Olfr710 UTSW 7 106944340 missense probably benign 0.01
R4647:Olfr710 UTSW 7 106944340 missense probably benign 0.01
R4661:Olfr710 UTSW 7 106944867 missense probably damaging 0.98
R4679:Olfr710 UTSW 7 106944945 missense probably benign 0.10
R5200:Olfr710 UTSW 7 106944980 missense possibly damaging 0.77
R6744:Olfr710 UTSW 7 106944534 missense probably damaging 1.00
R6908:Olfr710 UTSW 7 106944632 missense possibly damaging 0.82
R7463:Olfr710 UTSW 7 106944173 missense probably damaging 0.99
R7498:Olfr710 UTSW 7 106944368 missense possibly damaging 0.93
RF003:Olfr710 UTSW 7 106944648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGAGAAAACCTTGAGCCTCC -3'
(R):5'- GGGGTGTACAGAAAGCTCTCTTC -3'

Sequencing Primer
(F):5'- CCTGATTGTATTTGAACCACAGTGG -3'
(R):5'- AGAAAGCTCTCTTCTGGCAG -3'
Posted On2016-10-05