Incidental Mutation 'R5495:Ogfod1'
ID432292
Institutional Source Beutler Lab
Gene Symbol Ogfod1
Ensembl Gene ENSMUSG00000033009
Gene Name2-oxoglutarate and iron-dependent oxygenase domain containing 1
Synonyms4930415J21Rik
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5495 (G1)
Quality Score213
Status Not validated
Chromosome8
Chromosomal Location94037198-94067921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94064278 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 526 (Q526K)
Ref Sequence ENSEMBL: ENSMUSP00000105183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034206] [ENSMUST00000060632] [ENSMUST00000093301] [ENSMUST00000109556]
Predicted Effect probably benign
Transcript: ENSMUST00000034206
SMART Domains Protein: ENSMUSP00000034206
Gene: ENSMUSG00000031755

DomainStartEndE-ValueType
Pfam:BBS2_N 20 161 1.4e-62 PFAM
Pfam:BBS2_Mid 162 272 6.9e-50 PFAM
Pfam:BBS2_C 276 715 2.6e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060632
AA Change: Q511K

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051430
Gene: ENSMUSG00000033009
AA Change: Q511K

DomainStartEndE-ValueType
P4Hc 46 223 4.87e-26 SMART
Pfam:Ofd1_CTDD 246 513 1.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093301
AA Change: Q483K

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000090991
Gene: ENSMUSG00000033009
AA Change: Q483K

DomainStartEndE-ValueType
P4Hc 61 228 2.6e-12 SMART
low complexity region 328 353 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109556
AA Change: Q526K

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105183
Gene: ENSMUSG00000033009
AA Change: Q526K

DomainStartEndE-ValueType
P4Hc 61 238 4.87e-26 SMART
Pfam:Ofd1_CTDD 261 528 7.2e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170208
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Ogfod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Ogfod1 APN 8 94063006 missense probably damaging 1.00
IGL01296:Ogfod1 APN 8 94055671 splice site probably benign
IGL01369:Ogfod1 APN 8 94063091 critical splice donor site probably null
IGL02113:Ogfod1 APN 8 94064213 missense probably damaging 1.00
IGL02228:Ogfod1 APN 8 94062987 missense probably benign 0.00
IGL03057:Ogfod1 APN 8 94056138 missense possibly damaging 0.78
IGL03071:Ogfod1 APN 8 94057767 missense probably damaging 1.00
R0391:Ogfod1 UTSW 8 94063023 missense probably damaging 1.00
R0395:Ogfod1 UTSW 8 94063528 critical splice donor site probably null
R0518:Ogfod1 UTSW 8 94055248 splice site probably null
R0605:Ogfod1 UTSW 8 94047267 splice site probably benign
R0708:Ogfod1 UTSW 8 94039045 missense possibly damaging 0.89
R0763:Ogfod1 UTSW 8 94055636 missense probably benign 0.03
R1101:Ogfod1 UTSW 8 94064304 missense probably benign
R1244:Ogfod1 UTSW 8 94037371 missense probably benign
R1332:Ogfod1 UTSW 8 94058099 missense probably damaging 1.00
R1336:Ogfod1 UTSW 8 94058099 missense probably damaging 1.00
R2301:Ogfod1 UTSW 8 94037368 missense probably damaging 0.99
R3025:Ogfod1 UTSW 8 94063052 missense probably damaging 1.00
R3710:Ogfod1 UTSW 8 94057752 nonsense probably null
R4612:Ogfod1 UTSW 8 94037347 missense possibly damaging 0.66
R5349:Ogfod1 UTSW 8 94055248 splice site probably benign
R5690:Ogfod1 UTSW 8 94058141 missense probably damaging 0.99
R6355:Ogfod1 UTSW 8 94062982 missense probably benign
R7282:Ogfod1 UTSW 8 94037439 missense possibly damaging 0.47
R7396:Ogfod1 UTSW 8 94038987 missense probably benign 0.00
R7651:Ogfod1 UTSW 8 94037353 missense probably benign 0.04
X0027:Ogfod1 UTSW 8 94037404 missense probably benign 0.08
Z1177:Ogfod1 UTSW 8 94037309 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCACCTGCTCTGTGATGAC -3'
(R):5'- ATAGCTCTAGCATGAGGTCTAGATG -3'

Sequencing Primer
(F):5'- TCTGTGATGACTCCCCCGAG -3'
(R):5'- TGTAAGCCACACTGACCTTGG -3'
Posted On2016-10-05