Incidental Mutation 'R5495:Nfat5'
ID432294
Institutional Source Beutler Lab
Gene Symbol Nfat5
Ensembl Gene ENSMUSG00000003847
Gene Namenuclear factor of activated T cells 5
SynonymsOREBP, nfatz, TonEBP, B130038B15Rik
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location107293470-107379517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107368447 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1107 (I1107V)
Ref Sequence ENSEMBL: ENSMUSP00000127784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075922] [ENSMUST00000077440] [ENSMUST00000125721] [ENSMUST00000133026] [ENSMUST00000144100] [ENSMUST00000147588] [ENSMUST00000151114] [ENSMUST00000154474] [ENSMUST00000169453]
Predicted Effect probably benign
Transcript: ENSMUST00000075922
AA Change: I1089V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000075311
Gene: ENSMUSG00000003847
AA Change: I1089V

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 7.8e-23 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077440
AA Change: I1013V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000076653
Gene: ENSMUSG00000003847
AA Change: I1013V

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:RHD 206 363 1.5e-22 PFAM
IPT 368 466 3.33e-15 SMART
low complexity region 571 577 N/A INTRINSIC
low complexity region 658 678 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 839 844 N/A INTRINSIC
low complexity region 887 901 N/A INTRINSIC
internal_repeat_2 927 1110 7.13e-8 PROSPERO
internal_repeat_1 935 1128 2.59e-11 PROSPERO
internal_repeat_2 1122 1324 7.13e-8 PROSPERO
internal_repeat_1 1207 1426 2.59e-11 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000125721
AA Change: I1089V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116094
Gene: ENSMUSG00000003847
AA Change: I1089V

DomainStartEndE-ValueType
low complexity region 52 98 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
Pfam:RHD 282 439 1e-22 PFAM
IPT 444 542 3.33e-15 SMART
low complexity region 647 653 N/A INTRINSIC
low complexity region 734 754 N/A INTRINSIC
low complexity region 793 810 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 915 920 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
internal_repeat_2 1003 1186 2.22e-8 PROSPERO
internal_repeat_1 1011 1204 5.31e-12 PROSPERO
internal_repeat_2 1198 1400 2.22e-8 PROSPERO
internal_repeat_1 1283 1502 5.31e-12 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126397
Predicted Effect probably benign
Transcript: ENSMUST00000133026
SMART Domains Protein: ENSMUSP00000116631
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 70 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144100
Predicted Effect probably benign
Transcript: ENSMUST00000147588
AA Change: I588V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000122871
Gene: ENSMUSG00000003847
AA Change: I588V

DomainStartEndE-ValueType
Blast:IPT 1 42 3e-20 BLAST
PDB:1IMH|D 1 44 2e-20 PDB
SCOP:d1bfta_ 1 44 3e-14 SMART
low complexity region 146 152 N/A INTRINSIC
low complexity region 233 253 N/A INTRINSIC
low complexity region 292 309 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
low complexity region 414 419 N/A INTRINSIC
low complexity region 462 476 N/A INTRINSIC
internal_repeat_2 502 685 1.17e-6 PROSPERO
internal_repeat_1 510 703 1.39e-9 PROSPERO
internal_repeat_2 697 899 1.17e-6 PROSPERO
internal_repeat_1 782 1001 1.39e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000151114
AA Change: I1107V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119370
Gene: ENSMUSG00000003847
AA Change: I1107V

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000154474
SMART Domains Protein: ENSMUSP00000115036
Gene: ENSMUSG00000003847

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169453
AA Change: I1107V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127784
Gene: ENSMUSG00000003847
AA Change: I1107V

DomainStartEndE-ValueType
low complexity region 70 116 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
Pfam:RHD_DNA_bind 300 457 1.1e-22 PFAM
IPT 462 560 3.33e-15 SMART
low complexity region 665 671 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 811 828 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
low complexity region 933 938 N/A INTRINSIC
low complexity region 981 995 N/A INTRINSIC
internal_repeat_2 1021 1204 2.24e-8 PROSPERO
internal_repeat_1 1029 1222 5.32e-12 PROSPERO
internal_repeat_2 1216 1418 2.24e-8 PROSPERO
internal_repeat_1 1301 1520 5.32e-12 PROSPERO
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells family of transcription factors. Proteins belonging to this family play a central role in inducible gene transcription during the immune response. This protein regulates gene expression induced by osmotic stress in mammalian cells. Unlike monomeric members of this protein family, this protein exists as a homodimer and forms stable dimers with DNA elements. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one of several knock-out allele exhibit lethality between E14.5 and E17.5 as well as around P10 with kidney, cardiac or immune defects depending on the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Nfat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Nfat5 APN 8 107367514 missense probably damaging 1.00
IGL01145:Nfat5 APN 8 107367215 missense probably damaging 0.99
IGL01700:Nfat5 APN 8 107339130 missense probably damaging 0.99
IGL01721:Nfat5 APN 8 107344979 critical splice donor site probably null
IGL01796:Nfat5 APN 8 107367641 missense probably damaging 1.00
IGL01976:Nfat5 APN 8 107367559 missense probably damaging 1.00
IGL02063:Nfat5 APN 8 107361818 missense probably benign 0.03
IGL02150:Nfat5 APN 8 107367952 nonsense probably null
IGL02174:Nfat5 APN 8 107339051 missense probably damaging 1.00
IGL02224:Nfat5 APN 8 107344815 missense probably benign 0.00
IGL02226:Nfat5 APN 8 107351522 nonsense probably null
IGL02324:Nfat5 APN 8 107366176 splice site probably benign
IGL02724:Nfat5 APN 8 107358735 missense probably damaging 0.97
fettfeld UTSW 8 107347727 missense probably damaging 1.00
Grunefeld UTSW 8 107355508 unclassified probably null
Kleinfeld UTSW 8 107351438 missense probably damaging 1.00
H8562:Nfat5 UTSW 8 107339382 splice site probably benign
R0003:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0117:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0118:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0119:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0135:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0138:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0141:Nfat5 UTSW 8 107339075 missense probably damaging 1.00
R0302:Nfat5 UTSW 8 107358701 missense probably damaging 1.00
R0420:Nfat5 UTSW 8 107367461 missense probably damaging 1.00
R0613:Nfat5 UTSW 8 107366295 missense possibly damaging 0.83
R0691:Nfat5 UTSW 8 107355605 missense probably damaging 1.00
R0743:Nfat5 UTSW 8 107368066 missense probably damaging 1.00
R1329:Nfat5 UTSW 8 107369027 missense probably benign 0.42
R1550:Nfat5 UTSW 8 107370573 missense probably damaging 0.99
R1590:Nfat5 UTSW 8 107293890 missense probably damaging 1.00
R1778:Nfat5 UTSW 8 107361789 missense probably damaging 1.00
R1827:Nfat5 UTSW 8 107367334 missense probably benign 0.00
R1918:Nfat5 UTSW 8 107366236 missense probably damaging 0.97
R2679:Nfat5 UTSW 8 107344914 missense probably damaging 1.00
R2850:Nfat5 UTSW 8 107293860 missense probably damaging 1.00
R3703:Nfat5 UTSW 8 107351421 splice site probably benign
R3966:Nfat5 UTSW 8 107367289 missense possibly damaging 0.47
R4301:Nfat5 UTSW 8 107355695 intron probably benign
R4596:Nfat5 UTSW 8 107351500 missense possibly damaging 0.93
R4602:Nfat5 UTSW 8 107367223 nonsense probably null
R4627:Nfat5 UTSW 8 107369276 missense probably damaging 1.00
R4917:Nfat5 UTSW 8 107324652 missense probably damaging 1.00
R4918:Nfat5 UTSW 8 107324652 missense probably damaging 1.00
R5089:Nfat5 UTSW 8 107351438 missense probably damaging 1.00
R5566:Nfat5 UTSW 8 107369135 missense possibly damaging 0.47
R5851:Nfat5 UTSW 8 107347727 missense probably damaging 1.00
R6012:Nfat5 UTSW 8 107367133 missense probably benign 0.09
R6018:Nfat5 UTSW 8 107355651 critical splice donor site probably null
R6364:Nfat5 UTSW 8 107368277 missense probably benign 0.00
R6404:Nfat5 UTSW 8 107370588 missense probably benign 0.01
R6466:Nfat5 UTSW 8 107355508 unclassified probably null
R7056:Nfat5 UTSW 8 107368106 missense probably damaging 1.00
R7105:Nfat5 UTSW 8 107369191 missense possibly damaging 0.88
R7128:Nfat5 UTSW 8 107358691 missense probably benign 0.10
R7214:Nfat5 UTSW 8 107293883 missense probably damaging 0.99
R7276:Nfat5 UTSW 8 107367099 missense probably benign 0.25
R7560:Nfat5 UTSW 8 107370589 missense probably benign 0.15
R7844:Nfat5 UTSW 8 107358668 missense probably damaging 1.00
R7927:Nfat5 UTSW 8 107358668 missense probably damaging 1.00
X0022:Nfat5 UTSW 8 107347756 nonsense probably null
Z1177:Nfat5 UTSW 8 107338842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTACCCAGCAACAAGGG -3'
(R):5'- AGAAATTGAGTTCTGTGCTGC -3'

Sequencing Primer
(F):5'- CAAGGGAATAGCTTGTTCCAGC -3'
(R):5'- AATGAAATCTGCTCTTCTTGGGC -3'
Posted On2016-10-05