Incidental Mutation 'R5495:Casp12'
ID432295
Institutional Source Beutler Lab
Gene Symbol Casp12
Ensembl Gene ENSMUSG00000025887
Gene Namecaspase 12
Synonyms
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location5345430-5373032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5353797 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 277 (I277N)
Ref Sequence ENSEMBL: ENSMUSP00000027009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027009] [ENSMUST00000151332] [ENSMUST00000151788]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027009
AA Change: I277N

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027009
Gene: ENSMUSG00000025887
AA Change: I277N

DomainStartEndE-ValueType
CARD 1 83 3.54e-2 SMART
CASc 165 417 2.59e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149520
Predicted Effect probably benign
Transcript: ENSMUST00000151332
AA Change: I207N

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122201
Gene: ENSMUSG00000025887
AA Change: I207N

DomainStartEndE-ValueType
CASc 95 347 2.59e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151788
SMART Domains Protein: ENSMUSP00000121565
Gene: ENSMUSG00000025887

DomainStartEndE-ValueType
CARD 1 83 3.54e-2 SMART
Pfam:Peptidase_C14 176 230 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for some mutations of this gene display resistance to ER stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Casp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Casp12 APN 9 5352665 splice site probably null
IGL00717:Casp12 APN 9 5352702 missense probably damaging 1.00
IGL02326:Casp12 APN 9 5358317 missense possibly damaging 0.92
R0016:Casp12 UTSW 9 5352844 missense probably null 0.01
R0016:Casp12 UTSW 9 5352844 missense probably null 0.01
R0329:Casp12 UTSW 9 5345534 splice site probably benign
R0392:Casp12 UTSW 9 5348973 splice site probably benign
R0584:Casp12 UTSW 9 5352268 missense probably null 0.00
R0609:Casp12 UTSW 9 5346554 missense probably damaging 1.00
R1099:Casp12 UTSW 9 5352204 missense probably benign
R1951:Casp12 UTSW 9 5348959 critical splice donor site probably null
R2034:Casp12 UTSW 9 5346491 missense probably damaging 0.97
R4208:Casp12 UTSW 9 5346629 missense probably damaging 1.00
R4558:Casp12 UTSW 9 5352742 missense probably damaging 1.00
R4592:Casp12 UTSW 9 5352923 intron probably benign
R4597:Casp12 UTSW 9 5348941 missense possibly damaging 0.55
R4913:Casp12 UTSW 9 5358726 missense probably damaging 1.00
R4965:Casp12 UTSW 9 5352250 missense probably benign 0.00
R5777:Casp12 UTSW 9 5354548 missense probably benign 0.01
R6641:Casp12 UTSW 9 5354612 missense probably benign
R7159:Casp12 UTSW 9 5353763 missense possibly damaging 0.89
R7320:Casp12 UTSW 9 5348897 critical splice acceptor site probably null
R7349:Casp12 UTSW 9 5345527 critical splice donor site probably null
R7636:Casp12 UTSW 9 5358344 missense probably benign 0.15
R7695:Casp12 UTSW 9 5353641 missense probably damaging 0.99
R7819:Casp12 UTSW 9 5352805 missense probably damaging 1.00
R8071:Casp12 UTSW 9 5346647 missense probably damaging 1.00
Z1088:Casp12 UTSW 9 5354582 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCCCAAATTGCTTGACTGATAG -3'
(R):5'- TCTTTTGGCCTGGACACACC -3'

Sequencing Primer
(F):5'- AGAATTCATTGGGTTTGACTCTAGAG -3'
(R):5'- TGGACACACCAGTAGTACTAAAATG -3'
Posted On2016-10-05