Incidental Mutation 'R5495:Bcl11a'
ID432300
Institutional Source Beutler Lab
Gene Symbol Bcl11a
Ensembl Gene ENSMUSG00000000861
Gene NameB cell CLL/lymphoma 11A (zinc finger protein)
Synonyms2810047E18Rik, Evi9c, Evi9, Evi9b, Evi9a, COUP-TF interacting protein 1, D930021L15Rik, CTIP1, mouse myeloid leukemia gene
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location24078056-24174123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24165042 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 795 (V795E)
Ref Sequence ENSEMBL: ENSMUSP00000105140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000881] [ENSMUST00000109514] [ENSMUST00000109516] [ENSMUST00000118955]
Predicted Effect probably benign
Transcript: ENSMUST00000000881
SMART Domains Protein: ENSMUSP00000000881
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 45 73 5.9e-9 PFAM
ZnF_C2H2 170 193 7.15e-2 SMART
low complexity region 258 274 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 352 373 N/A INTRINSIC
ZnF_C2H2 377 399 6.23e-2 SMART
ZnF_C2H2 405 427 1.69e-3 SMART
low complexity region 456 472 N/A INTRINSIC
coiled coil region 481 513 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
low complexity region 682 696 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109514
AA Change: V795E

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105140
Gene: ENSMUSG00000000861
AA Change: V795E

DomainStartEndE-ValueType
Blast:ZnF_C2H2 46 72 8e-10 BLAST
ZnF_C2H2 170 193 7.15e-2 SMART
low complexity region 258 274 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 352 373 N/A INTRINSIC
ZnF_C2H2 377 399 6.23e-2 SMART
ZnF_C2H2 405 427 1.69e-3 SMART
low complexity region 456 472 N/A INTRINSIC
coiled coil region 481 513 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
low complexity region 682 696 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
ZnF_C2H2 742 764 1.41e0 SMART
ZnF_C2H2 770 792 4.24e-4 SMART
ZnF_C2H2 800 823 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109516
SMART Domains Protein: ENSMUSP00000105142
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 45 73 3.2e-8 PFAM
ZnF_C2H2 170 193 7.15e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118955
SMART Domains Protein: ENSMUSP00000112948
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
ZnF_C2H2 118 141 7.15e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146717
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 type zinc-finger protein by its similarity to the mouse Bcl11a/Evi9 protein. The corresponding mouse gene is a common site of retroviral integration in myeloid leukemia, and may function as a leukemia disease gene, in part, through its interaction with BCL6. During hematopoietic cell differentiation, this gene is down-regulated. It is possibly involved in lymphoma pathogenesis since translocations associated with B-cell malignancies also deregulates its expression. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in B cell deficiency, alteration of T cell types, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Bcl11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Bcl11a APN 11 24163346 missense probably benign 0.00
IGL03190:Bcl11a APN 11 24158333 missense probably benign 0.00
R0317:Bcl11a UTSW 11 24172697 critical splice acceptor site probably null
R1061:Bcl11a UTSW 11 24164069 nonsense probably null
R1124:Bcl11a UTSW 11 24163928 missense probably damaging 1.00
R1163:Bcl11a UTSW 11 24165143 missense probably benign 0.41
R1498:Bcl11a UTSW 11 24164005 missense probably damaging 1.00
R1599:Bcl11a UTSW 11 24163887 missense probably damaging 1.00
R1689:Bcl11a UTSW 11 24163167 missense probably damaging 1.00
R1689:Bcl11a UTSW 11 24164406 missense possibly damaging 0.66
R1754:Bcl11a UTSW 11 24164724 missense probably damaging 1.00
R2036:Bcl11a UTSW 11 24164087 missense possibly damaging 0.71
R2207:Bcl11a UTSW 11 24163343 missense probably damaging 1.00
R3700:Bcl11a UTSW 11 24163890 missense probably damaging 1.00
R3779:Bcl11a UTSW 11 24164568 missense probably damaging 1.00
R4557:Bcl11a UTSW 11 24164004 missense probably damaging 1.00
R4703:Bcl11a UTSW 11 24163725 missense possibly damaging 0.80
R5006:Bcl11a UTSW 11 24164989 nonsense probably null
R5053:Bcl11a UTSW 11 24164068 missense probably benign 0.03
R5581:Bcl11a UTSW 11 24163932 missense probably damaging 1.00
R5680:Bcl11a UTSW 11 24164264 missense possibly damaging 0.52
R5790:Bcl11a UTSW 11 24163650 missense probably damaging 1.00
R6291:Bcl11a UTSW 11 24158321 missense probably damaging 0.96
R6723:Bcl11a UTSW 11 24163646 missense probably damaging 1.00
R7116:Bcl11a UTSW 11 24163839 missense probably damaging 1.00
R7274:Bcl11a UTSW 11 24163985 missense probably damaging 1.00
R7569:Bcl11a UTSW 11 24085458 nonsense probably null
R7843:Bcl11a UTSW 11 24164831 missense probably benign 0.26
R7926:Bcl11a UTSW 11 24164831 missense probably benign 0.26
R8242:Bcl11a UTSW 11 24163208 missense probably benign 0.14
Z1176:Bcl11a UTSW 11 24165010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCCCCATATTAGTGGTCC -3'
(R):5'- TGCTGGTGACAAGCACTCATTC -3'

Sequencing Primer
(F):5'- ATATTAGTGGTCCGGGCCC -3'
(R):5'- CTGGTGACAAGCACTCATTCATATTC -3'
Posted On2016-10-05