Incidental Mutation 'R5495:Prl6a1'
ID432304
Institutional Source Beutler Lab
Gene Symbol Prl6a1
Ensembl Gene ENSMUSG00000069259
Gene Nameprolactin family 6, subfamily a, member 1
SynonymsPLP-B, Prlpb
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location27312627-27319252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27312671 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 3 (S3P)
Ref Sequence ENSEMBL: ENSMUSP00000089269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091679] [ENSMUST00000091680]
Predicted Effect probably benign
Transcript: ENSMUST00000091679
SMART Domains Protein: ENSMUSP00000089268
Gene: ENSMUSG00000069259

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Hormone_1 21 235 8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000091680
AA Change: S3P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089269
Gene: ENSMUSG00000069259
AA Change: S3P

DomainStartEndE-ValueType
Pfam:Hormone_1 16 230 1.1e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119758
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Prl6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Prl6a1 APN 13 27316364 missense possibly damaging 0.72
IGL01688:Prl6a1 APN 13 27317986 missense probably damaging 1.00
IGL01922:Prl6a1 APN 13 27315360 missense possibly damaging 0.57
IGL02059:Prl6a1 APN 13 27315365 missense probably benign 0.02
IGL03170:Prl6a1 APN 13 27315423 missense possibly damaging 0.95
R0027:Prl6a1 UTSW 13 27318028 missense probably damaging 1.00
R0027:Prl6a1 UTSW 13 27318028 missense probably damaging 1.00
R0049:Prl6a1 UTSW 13 27317997 missense probably damaging 0.99
R0606:Prl6a1 UTSW 13 27314194 intron probably benign
R0944:Prl6a1 UTSW 13 27318166 splice site probably benign
R1518:Prl6a1 UTSW 13 27318927 missense possibly damaging 0.72
R1518:Prl6a1 UTSW 13 27318928 missense probably null 0.19
R1566:Prl6a1 UTSW 13 27315427 missense possibly damaging 0.84
R1621:Prl6a1 UTSW 13 27318010 missense probably benign 0.01
R2011:Prl6a1 UTSW 13 27315369 missense probably benign 0.00
R2058:Prl6a1 UTSW 13 27319098 missense probably benign 0.05
R2937:Prl6a1 UTSW 13 27315320 missense probably damaging 0.98
R3079:Prl6a1 UTSW 13 27319000 missense possibly damaging 0.71
R4685:Prl6a1 UTSW 13 27316324 missense probably benign 0.00
R4856:Prl6a1 UTSW 13 27319000 missense probably damaging 0.98
R4886:Prl6a1 UTSW 13 27319000 missense probably damaging 0.98
R5923:Prl6a1 UTSW 13 27316363 missense probably benign 0.08
R6772:Prl6a1 UTSW 13 27319048 missense probably damaging 1.00
R7411:Prl6a1 UTSW 13 27318142 missense probably damaging 1.00
R7501:Prl6a1 UTSW 13 27316299 missense possibly damaging 0.69
R7549:Prl6a1 UTSW 13 27318971 missense probably damaging 0.96
R7563:Prl6a1 UTSW 13 27314238 critical splice donor site probably null
R7773:Prl6a1 UTSW 13 27318142 missense probably damaging 1.00
Z1177:Prl6a1 UTSW 13 27315321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTTAACATTCCCTGAAGC -3'
(R):5'- CTGAGCAAGTCCTTTCTAGATTATG -3'

Sequencing Primer
(F):5'- GCAGGACAGTAATTGGAACCTATTTG -3'
(R):5'- GTCAGCCAATAACCTTGG -3'
Posted On2016-10-05