Incidental Mutation 'R5495:Egflam'
ID432307
Institutional Source Beutler Lab
Gene Symbol Egflam
Ensembl Gene ENSMUSG00000042961
Gene NameEGF-like, fibronectin type III and laminin G domains
Synonymsnectican, pikachurin
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location7206120-7398395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7251241 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 434 (R434S)
Ref Sequence ENSEMBL: ENSMUSP00000094238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058593] [ENSMUST00000096494] [ENSMUST00000160207]
Predicted Effect probably damaging
Transcript: ENSMUST00000058593
AA Change: R434S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055599
Gene: ENSMUSG00000042961
AA Change: R434S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 852 988 1.47e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096494
AA Change: R434S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094238
Gene: ENSMUSG00000042961
AA Change: R434S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 860 996 1.47e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162105
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile under normal conditions. They exhibit abnormal photoreceptor ribbon synapses, resulting in alteration in synaptic signal transmission and visual function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Egflam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Egflam APN 15 7219764 missense probably damaging 1.00
IGL02352:Egflam APN 15 7234225 missense probably benign 0.01
IGL02359:Egflam APN 15 7234225 missense probably benign 0.01
IGL02389:Egflam APN 15 7250078 missense probably benign 0.01
IGL02400:Egflam APN 15 7247053 missense probably benign 0.00
IGL02530:Egflam APN 15 7222812 missense probably damaging 1.00
IGL02892:Egflam APN 15 7289796 missense probably benign
R0047:Egflam UTSW 15 7253430 missense possibly damaging 0.56
R0047:Egflam UTSW 15 7253430 missense possibly damaging 0.56
R0345:Egflam UTSW 15 7289994 intron probably null
R0504:Egflam UTSW 15 7222758 missense probably damaging 1.00
R0532:Egflam UTSW 15 7234237 missense probably benign 0.19
R0573:Egflam UTSW 15 7242425 nonsense probably null
R0609:Egflam UTSW 15 7253523 missense possibly damaging 0.65
R0648:Egflam UTSW 15 7207709 missense probably damaging 1.00
R0653:Egflam UTSW 15 7250028 critical splice donor site probably null
R1099:Egflam UTSW 15 7252422 missense probably benign 0.00
R1711:Egflam UTSW 15 7289915 missense possibly damaging 0.85
R1842:Egflam UTSW 15 7303941 missense probably benign 0.00
R1964:Egflam UTSW 15 7247105 missense probably damaging 0.97
R2001:Egflam UTSW 15 7242567 missense probably benign 0.18
R2008:Egflam UTSW 15 7237804 missense possibly damaging 0.95
R2134:Egflam UTSW 15 7234279 missense probably damaging 0.97
R2852:Egflam UTSW 15 7219701 missense probably damaging 1.00
R2853:Egflam UTSW 15 7219701 missense probably damaging 1.00
R4257:Egflam UTSW 15 7254426 splice site probably null
R4346:Egflam UTSW 15 7234278 nonsense probably null
R4380:Egflam UTSW 15 7243869 missense possibly damaging 0.70
R4538:Egflam UTSW 15 7252437 missense probably damaging 1.00
R4746:Egflam UTSW 15 7224639 splice site probably null
R4909:Egflam UTSW 15 7219629 missense probably damaging 1.00
R5027:Egflam UTSW 15 7253644 missense probably benign 0.00
R5314:Egflam UTSW 15 7304012 missense probably damaging 1.00
R5439:Egflam UTSW 15 7224663 missense probably damaging 0.99
R5626:Egflam UTSW 15 7251207 missense possibly damaging 0.89
R5931:Egflam UTSW 15 7243857 missense possibly damaging 0.49
R5977:Egflam UTSW 15 7318245 missense possibly damaging 0.94
R6258:Egflam UTSW 15 7234292 missense probably damaging 0.98
R6395:Egflam UTSW 15 7231695 missense probably damaging 1.00
R6497:Egflam UTSW 15 7251303 splice site probably null
R6736:Egflam UTSW 15 7219725 missense probably damaging 1.00
R7586:Egflam UTSW 15 7208601 missense probably damaging 1.00
R7764:Egflam UTSW 15 7318255 missense probably damaging 0.98
R7781:Egflam UTSW 15 7253746 missense probably null 0.94
R7842:Egflam UTSW 15 7251194 missense probably null 1.00
R7925:Egflam UTSW 15 7251194 missense probably null 1.00
R8011:Egflam UTSW 15 7247044 missense possibly damaging 0.89
R8080:Egflam UTSW 15 7398080 missense probably benign 0.09
X0024:Egflam UTSW 15 7304013 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTCCGAAATGCAAATCTCAAAG -3'
(R):5'- ATGCTTGCGTCAGTAGGCTG -3'

Sequencing Primer
(F):5'- CTCCCCAGGATTAGAGACATTGG -3'
(R):5'- TGGAGGAGGAGAACATTCATGATTTG -3'
Posted On2016-10-05