Incidental Mutation 'R5495:Parp10'
ID432308
Institutional Source Beutler Lab
Gene Symbol Parp10
Ensembl Gene ENSMUSG00000063268
Gene Namepoly (ADP-ribose) polymerase family, member 10
Synonyms
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5495 (G1)
Quality Score172
Status Not validated
Chromosome15
Chromosomal Location76231174-76243441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 76243166 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 24 (I24L)
Ref Sequence ENSEMBL: ENSMUSP00000129765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023225] [ENSMUST00000075689] [ENSMUST00000165738] [ENSMUST00000229380] [ENSMUST00000229772] [ENSMUST00000230347]
Predicted Effect probably benign
Transcript: ENSMUST00000023225
SMART Domains Protein: ENSMUSP00000023225
Gene: ENSMUSG00000022564

DomainStartEndE-ValueType
low complexity region 27 101 N/A INTRINSIC
Pfam:Bax1-I 133 340 6.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075689
AA Change: I24L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075110
Gene: ENSMUSG00000063268
AA Change: I24L

DomainStartEndE-ValueType
Blast:RRM_2 9 72 1e-13 BLAST
PDB:2DHX|A 9 98 1e-30 PDB
low complexity region 183 193 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 566 575 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
UIM 605 624 9.27e1 SMART
UIM 628 647 1.88e1 SMART
low complexity region 728 738 N/A INTRINSIC
Pfam:PARP 766 954 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165738
AA Change: I24L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129765
Gene: ENSMUSG00000063268
AA Change: I24L

DomainStartEndE-ValueType
Blast:RRM_2 9 72 1e-13 BLAST
PDB:2DHX|A 9 98 1e-30 PDB
low complexity region 183 193 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 566 575 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
UIM 605 624 9.27e1 SMART
UIM 628 647 1.88e1 SMART
low complexity region 728 738 N/A INTRINSIC
Pfam:PARP 766 954 8.1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166151
Predicted Effect probably benign
Transcript: ENSMUST00000229380
Predicted Effect probably benign
Transcript: ENSMUST00000229772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229916
Predicted Effect probably benign
Transcript: ENSMUST00000230347
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) polymerases (PARPs), such as PARP10, regulate gene transcription by altering chromatin organization by adding ADP-ribose to histones. PARPs can also function as transcriptional cofactors (Yu et al., 2005 [PubMed 15674325]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Parp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Parp10 APN 15 76241677 missense probably benign 0.09
IGL01419:Parp10 APN 15 76241388 missense probably damaging 1.00
PIT4687001:Parp10 UTSW 15 76240922 missense probably benign 0.00
R0053:Parp10 UTSW 15 76242246 missense probably damaging 1.00
R0053:Parp10 UTSW 15 76242246 missense probably damaging 1.00
R0126:Parp10 UTSW 15 76243066 missense probably damaging 0.98
R0207:Parp10 UTSW 15 76242633 missense probably benign 0.00
R1300:Parp10 UTSW 15 76241990 missense possibly damaging 0.93
R1412:Parp10 UTSW 15 76243084 missense probably damaging 0.99
R1510:Parp10 UTSW 15 76241417 missense probably damaging 1.00
R1670:Parp10 UTSW 15 76242070 missense probably benign 0.01
R1875:Parp10 UTSW 15 76242851 missense probably damaging 1.00
R2219:Parp10 UTSW 15 76233583 missense probably damaging 1.00
R2351:Parp10 UTSW 15 76242856 missense probably benign
R4027:Parp10 UTSW 15 76241154 critical splice donor site probably null
R4659:Parp10 UTSW 15 76242985 missense probably damaging 1.00
R4763:Parp10 UTSW 15 76233427 missense probably damaging 0.99
R4828:Parp10 UTSW 15 76243081 missense probably benign 0.00
R5066:Parp10 UTSW 15 76240946 splice site probably benign
R5090:Parp10 UTSW 15 76241725 missense probably damaging 0.97
R6271:Parp10 UTSW 15 76242002 missense probably benign
R6335:Parp10 UTSW 15 76242188 missense probably benign 0.00
R6503:Parp10 UTSW 15 76242484 missense probably damaging 1.00
R6606:Parp10 UTSW 15 76240108 missense possibly damaging 0.66
R6868:Parp10 UTSW 15 76243106 missense probably damaging 1.00
R7197:Parp10 UTSW 15 76242416 missense probably damaging 1.00
X0027:Parp10 UTSW 15 76241504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCTCTTTGCATCTGTGAGC -3'
(R):5'- TAACTGACTGGCCTGAGACAC -3'

Sequencing Primer
(F):5'- TCTGTGAGCAGAGATGAAAGTGTC -3'
(R):5'- TGAGACACTGGCCTGAGAC -3'
Posted On2016-10-05