Incidental Mutation 'R5495:Lgals12'
ID432313
Institutional Source Beutler Lab
Gene Symbol Lgals12
Ensembl Gene ENSMUSG00000024972
Gene Namelectin, galactose binding, soluble 12
SynonymsGRIP1, galectin-12, galectin-related inhibitor of proliferation
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location7596660-7607193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7604130 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 71 (A71T)
Ref Sequence ENSEMBL: ENSMUSP00000124610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079902] [ENSMUST00000099729] [ENSMUST00000159983]
Predicted Effect probably damaging
Transcript: ENSMUST00000079902
AA Change: A71T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078824
Gene: ENSMUSG00000024972
AA Change: A71T

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 181 301 3.6e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099729
AA Change: A71T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097318
Gene: ENSMUSG00000024972
AA Change: A71T

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159983
AA Change: A71T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124610
Gene: ENSMUSG00000024972
AA Change: A71T

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galectin superfamily, a group of beta-galactoside-binding proteins with conserved carbohydrate recognition domains. The related mouse protein is a primary regulator of the early stages of adipose tissue development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lipolysis, reduced adiposity, and enhanced insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Lgals12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Lgals12 APN 19 7606654 splice site probably benign
IGL02630:Lgals12 APN 19 7601242 splice site probably benign
IGL02700:Lgals12 APN 19 7598090 missense probably benign 0.01
R0129:Lgals12 UTSW 19 7603038 missense probably damaging 0.99
R1398:Lgals12 UTSW 19 7603957 splice site probably benign
R1421:Lgals12 UTSW 19 7606714 missense probably benign 0.08
R1548:Lgals12 UTSW 19 7604312 missense probably benign 0.12
R1697:Lgals12 UTSW 19 7604165 missense possibly damaging 0.91
R2075:Lgals12 UTSW 19 7598845 missense possibly damaging 0.81
R2192:Lgals12 UTSW 19 7601241 splice site probably null
R2253:Lgals12 UTSW 19 7606765 start gained probably benign
R4256:Lgals12 UTSW 19 7606716 missense possibly damaging 0.93
R4738:Lgals12 UTSW 19 7604099 missense probably benign 0.01
R5810:Lgals12 UTSW 19 7606720 missense probably benign 0.00
R6139:Lgals12 UTSW 19 7604377 missense probably benign 0.07
R7414:Lgals12 UTSW 19 7603970 missense probably damaging 1.00
X0067:Lgals12 UTSW 19 7603964 splice site probably null
Z1177:Lgals12 UTSW 19 7598080 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTAAAGTGCCAGCTCCAGAC -3'
(R):5'- TCTGCATGCAAGGAGGTAAG -3'

Sequencing Primer
(F):5'- AGCTCCAGACTGCCTGATG -3'
(R):5'- TAAGGGGGACTGGCTAGGAC -3'
Posted On2016-10-05