Mutagenetix > Incidental Mutation

Incidental Mutation 'R5496:Cdh20'

432318

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

043057-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R5496 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104696254-104923206 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 109976647 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 104 (I104N)

Ref Sequence

ENSEMBL: ENSMUSP00000129715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]

AlphaFold

Q9Z0M3

Predicted Effect

probably damaging
Transcript: ENSMUST00000027542
AA Change: I104N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: I104N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	633	778	6e-54	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112701
AA Change: I104N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: I104N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	631	779	4e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131464

SMART Domains

Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
PDB:1ZVN\|B	49	70	1e-9	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000172005
AA Change: I104N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: I104N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	631	779	4e-58	PFAM

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.1%
20x: 90.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	G	A	5: 8,724,818 (GRCm39)	V84I	probably benign	Het
Adam10	T	G	9: 70,630,021 (GRCm39)	F151C	probably damaging	Het
Akap6	A	G	12: 53,187,436 (GRCm39)	S1617G	possibly damaging	Het
Ano6	T	A	15: 95,865,495 (GRCm39)		probably null	Het
Atmin	A	G	8: 117,683,911 (GRCm39)	T524A	probably benign	Het
Bicra	C	T	7: 15,721,766 (GRCm39)	V584I	probably benign	Het
Carmil1	G	A	13: 24,339,433 (GRCm39)	R54C	probably damaging	Het
Cbln1	A	G	8: 88,198,324 (GRCm39)	I127T	possibly damaging	Het
Ccl26	A	G	5: 135,592,217 (GRCm39)	V40A	probably benign	Het
Cdt1	C	T	8: 123,297,239 (GRCm39)	R311W	probably damaging	Het
Cfap91	A	G	16: 38,141,855 (GRCm39)	I359T	probably damaging	Het
Col12a1	A	G	9: 79,509,467 (GRCm39)		probably benign	Het
Csf2rb	A	G	15: 78,224,761 (GRCm39)	E173G	probably damaging	Het
Cyb561	A	G	11: 105,828,545 (GRCm39)	Y94H	probably damaging	Het
Cyp3a16	T	A	5: 145,404,341 (GRCm39)	K34M	probably damaging	Het
Diras2	C	T	13: 52,661,786 (GRCm39)	V174M	probably benign	Het
Dnah7a	T	G	1: 53,496,927 (GRCm39)	M3110L	probably benign	Het
Dyrk2	T	C	10: 118,695,956 (GRCm39)	E434G	probably damaging	Het
Ebag9	T	G	15: 44,503,816 (GRCm39)	*214E	probably null	Het
Egln3	A	T	12: 54,250,110 (GRCm39)	W80R	probably damaging	Het
Eps15l1	A	G	8: 73,136,619 (GRCm39)	Y336H	probably benign	Het
Gak	A	G	5: 108,724,483 (GRCm39)	S1076P	probably benign	Het
Glra1	T	C	11: 55,418,241 (GRCm39)	Y168C	probably damaging	Het
Glrx2	T	A	1: 143,620,945 (GRCm39)	M108K	probably damaging	Het
Gm3604	A	T	13: 62,519,393 (GRCm39)	S59T	possibly damaging	Het
Gm8212	A	T	14: 44,438,614 (GRCm39)		probably benign	Het
Gmcl1	G	T	6: 86,674,507 (GRCm39)	A457D	probably damaging	Het
H2-M11	T	C	17: 36,858,871 (GRCm39)	F137S	possibly damaging	Het
Ighv1-55	C	G	12: 115,172,140 (GRCm39)	W3S	probably damaging	Het
Il22	T	G	10: 118,041,002 (GRCm39)	V36G	possibly damaging	Het
Ints1	G	A	5: 139,740,953 (GRCm39)	A1904V	probably benign	Het
Iqgap2	A	G	13: 95,766,561 (GRCm39)	Y1481H	probably damaging	Het
Kcnn3	C	T	3: 89,516,797 (GRCm39)	A402V	possibly damaging	Het
Kif18b	A	T	11: 102,804,568 (GRCm39)	I362N	possibly damaging	Het
Kif5c	C	G	2: 49,620,202 (GRCm39)	A223G	possibly damaging	Het
Kntc1	A	G	5: 123,922,245 (GRCm39)	D948G	probably benign	Het
Krba1	A	G	6: 48,383,290 (GRCm39)	T229A	possibly damaging	Het
Leprot	T	A	4: 101,515,093 (GRCm39)	I113N	probably damaging	Het
Lrp1b	T	C	2: 40,817,985 (GRCm39)	D2415G	probably benign	Het
Mnd1	T	A	3: 83,995,481 (GRCm39)	D171V	probably damaging	Het
Mthfsd	A	T	8: 121,825,553 (GRCm39)	Y339*	probably null	Het
Nfatc2	G	A	2: 168,378,198 (GRCm39)	T268M	probably damaging	Het
Or14j10	T	C	17: 37,935,469 (GRCm39)	D19G	probably benign	Het
Or52d3	G	C	7: 104,229,701 (GRCm39)	A283P	probably damaging	Het
Or8h7	G	T	2: 86,720,658 (GRCm39)	P287Q	probably damaging	Het
Or8h7	G	C	2: 86,720,659 (GRCm39)	P287A	probably damaging	Het
Pan3	G	A	5: 147,463,938 (GRCm39)		probably null	Het
Pde6a	A	T	18: 61,386,736 (GRCm39)		probably null	Het
Prss39	T	C	1: 34,539,342 (GRCm39)	I194T	possibly damaging	Het
Rfx8	T	C	1: 39,709,507 (GRCm39)	S507G	probably benign	Het
Rif1	T	C	2: 51,988,928 (GRCm39)	S774P	probably damaging	Het
Sh3bp5	C	A	14: 31,099,452 (GRCm39)	R265L	probably benign	Het
Slc45a2	C	T	15: 11,027,871 (GRCm39)	T480I	probably damaging	Het
Smurf1	C	A	5: 144,819,403 (GRCm39)	E601*	probably null	Het
Stau2	T	C	1: 16,460,245 (GRCm39)	S231G	probably damaging	Het
Timp2	T	G	11: 118,194,707 (GRCm39)	M161L	probably benign	Het
Tlr5	T	C	1: 182,801,197 (GRCm39)	L167P	probably damaging	Het
Trhr	G	A	15: 44,060,932 (GRCm39)	A151T	probably benign	Het
Unc13d	A	G	11: 115,957,534 (GRCm39)	V807A	probably damaging	Het
Usp2	T	C	9: 43,996,505 (GRCm39)	V7A	possibly damaging	Het
Uspl1	A	G	5: 149,146,589 (GRCm39)	T447A	probably damaging	Het
Zan	A	G	5: 137,434,607 (GRCm39)	I2232T	unknown	Het
Zfp12	C	A	5: 143,230,550 (GRCm39)	C292*	probably null	Het
Zfp850	A	C	7: 27,706,771 (GRCm39)	M43R	probably damaging	Het
Zic5	G	A	14: 122,696,755 (GRCm39)	T620M	unknown	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104,881,612 (GRCm39)	missense	probably benign	0.05
IGL00742:Cdh20	APN	1	109,993,356 (GRCm39)	missense	probably benign	0.22
IGL00743:Cdh20	APN	1	104,875,153 (GRCm39)	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104,861,981 (GRCm39)	missense	probably benign
IGL00861:Cdh20	APN	1	109,988,718 (GRCm39)	splice site	probably benign
IGL01016:Cdh20	APN	1	110,036,686 (GRCm39)	critical splice donor site	probably null
IGL01393:Cdh20	APN	1	104,861,969 (GRCm39)	missense	probably benign
IGL01396:Cdh20	APN	1	104,875,154 (GRCm39)	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104,861,832 (GRCm39)	missense	probably benign	0.05
IGL01538:Cdh20	APN	1	109,988,870 (GRCm39)	missense	probably damaging	1.00
IGL01612:Cdh20	APN	1	104,921,895 (GRCm39)	missense	probably benign	0.02
IGL01763:Cdh20	APN	1	109,993,520 (GRCm39)	missense	probably benign	0.00
IGL01765:Cdh20	APN	1	109,988,836 (GRCm39)	missense	probably damaging	1.00
IGL01937:Cdh20	APN	1	110,065,826 (GRCm39)	missense	probably benign
IGL01947:Cdh20	APN	1	104,921,649 (GRCm39)	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104,868,762 (GRCm39)	missense	probably damaging	1.00
IGL02020:Cdh20	APN	1	110,066,078 (GRCm39)	missense	probably damaging	1.00
IGL02135:Cdh20	APN	1	110,066,004 (GRCm39)	nonsense	probably null
IGL02226:Cdh20	APN	1	104,881,816 (GRCm39)	splice site	probably benign
IGL02285:Cdh20	APN	1	110,065,921 (GRCm39)	missense	probably damaging	1.00
IGL02318:Cdh20	APN	1	104,881,764 (GRCm39)	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104,902,764 (GRCm39)	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104,875,190 (GRCm39)	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104,868,982 (GRCm39)	missense	probably damaging	1.00
IGL03237:Cdh20	APN	1	110,066,037 (GRCm39)	missense	possibly damaging	0.89
IGL03280:Cdh20	APN	1	110,036,498 (GRCm39)	nonsense	probably null
IGL03347:Cdh20	APN	1	110,065,973 (GRCm39)	missense	possibly damaging	0.53
IGL03385:Cdh20	APN	1	109,993,516 (GRCm39)	missense	possibly damaging	0.90
3-1:Cdh20	UTSW	1	104,875,145 (GRCm39)	missense	possibly damaging	0.84
BB002:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
BB012:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
IGL02802:Cdh20	UTSW	1	110,065,655 (GRCm39)	missense	probably damaging	1.00
IGL02991:Cdh20	UTSW	1	104,861,972 (GRCm39)	missense	probably benign
R0030:Cdh20	UTSW	1	110,065,798 (GRCm39)	nonsense	probably null
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0178:Cdh20	UTSW	1	104,902,776 (GRCm39)	missense	possibly damaging	0.82
R0255:Cdh20	UTSW	1	109,922,036 (GRCm39)	missense	probably benign	0.09
R0365:Cdh20	UTSW	1	110,036,486 (GRCm39)	missense	probably damaging	1.00
R0506:Cdh20	UTSW	1	110,027,844 (GRCm39)	missense	probably damaging	1.00
R0549:Cdh20	UTSW	1	110,036,674 (GRCm39)	missense	probably damaging	1.00
R0599:Cdh20	UTSW	1	109,980,696 (GRCm39)	missense	probably damaging	1.00
R0648:Cdh20	UTSW	1	109,993,337 (GRCm39)	splice site	probably benign
R1033:Cdh20	UTSW	1	110,012,783 (GRCm39)	missense	probably damaging	0.96
R1114:Cdh20	UTSW	1	104,906,739 (GRCm39)	missense	probably damaging	0.96
R1173:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1174:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1175:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1401:Cdh20	UTSW	1	104,875,222 (GRCm39)	missense	possibly damaging	0.65
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1502:Cdh20	UTSW	1	104,881,755 (GRCm39)	missense	probably benign	0.06
R1587:Cdh20	UTSW	1	110,027,757 (GRCm39)	missense	probably damaging	0.98
R1728:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1729:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1730:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1739:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1762:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1764:Cdh20	UTSW	1	104,862,070 (GRCm39)	splice site	probably benign
R1769:Cdh20	UTSW	1	109,980,606 (GRCm39)	missense	probably damaging	1.00
R1783:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1785:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1940:Cdh20	UTSW	1	109,976,754 (GRCm39)	missense	probably benign	0.09
R1972:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1973:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1997:Cdh20	UTSW	1	109,976,668 (GRCm39)	missense	probably damaging	1.00
R2060:Cdh20	UTSW	1	109,976,607 (GRCm39)	missense	probably damaging	1.00
R2068:Cdh20	UTSW	1	110,065,666 (GRCm39)	nonsense	probably null
R2069:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R2137:Cdh20	UTSW	1	110,027,836 (GRCm39)	missense	probably damaging	0.97
R2155:Cdh20	UTSW	1	109,976,594 (GRCm39)	missense	probably damaging	1.00
R2198:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R2279:Cdh20	UTSW	1	104,875,139 (GRCm39)	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104,902,740 (GRCm39)	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104,875,199 (GRCm39)	missense	probably damaging	1.00
R3780:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3781:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3782:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R4115:Cdh20	UTSW	1	110,066,039 (GRCm39)	missense	probably benign	0.37
R4243:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4277:Cdh20	UTSW	1	109,993,418 (GRCm39)	missense	probably benign	0.00
R4299:Cdh20	UTSW	1	109,988,731 (GRCm39)	missense	probably damaging	0.99
R4349:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104,862,035 (GRCm39)	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104,912,410 (GRCm39)	missense	probably damaging	0.99
R4777:Cdh20	UTSW	1	109,922,055 (GRCm39)	nonsense	probably null
R4795:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4907:Cdh20	UTSW	1	110,066,053 (GRCm39)	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104,912,528 (GRCm39)	missense	probably damaging	1.00
R5045:Cdh20	UTSW	1	110,026,080 (GRCm39)	missense	probably benign	0.01
R5056:Cdh20	UTSW	1	104,881,722 (GRCm39)	missense	probably benign	0.00
R5059:Cdh20	UTSW	1	109,993,430 (GRCm39)	missense	probably damaging	0.98
R5127:Cdh20	UTSW	1	104,875,073 (GRCm39)	missense	probably damaging	1.00
R5146:Cdh20	UTSW	1	109,922,042 (GRCm39)	missense	probably damaging	0.97
R5196:Cdh20	UTSW	1	110,065,730 (GRCm39)	missense	probably damaging	0.99
R5269:Cdh20	UTSW	1	104,861,882 (GRCm39)	missense	possibly damaging	0.67
R5304:Cdh20	UTSW	1	110,036,569 (GRCm39)	missense	probably damaging	1.00
R5563:Cdh20	UTSW	1	104,875,082 (GRCm39)	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104,902,800 (GRCm39)	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104,912,635 (GRCm39)	missense	probably damaging	1.00
R5743:Cdh20	UTSW	1	110,036,575 (GRCm39)	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.49
R5867:Cdh20	UTSW	1	109,976,581 (GRCm39)	missense	probably damaging	1.00
R5933:Cdh20	UTSW	1	104,912,396 (GRCm39)	missense	probably damaging	1.00
R6042:Cdh20	UTSW	1	110,065,997 (GRCm39)	missense	probably damaging	0.97
R6092:Cdh20	UTSW	1	110,026,036 (GRCm39)	missense	probably benign	0.00
R6109:Cdh20	UTSW	1	104,921,739 (GRCm39)	missense	probably damaging	1.00
R6497:Cdh20	UTSW	1	109,993,528 (GRCm39)	critical splice donor site	probably null
R6521:Cdh20	UTSW	1	104,869,859 (GRCm39)	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104,912,411 (GRCm39)	missense	possibly damaging	0.95
R7111:Cdh20	UTSW	1	110,065,638 (GRCm39)	missense
R7169:Cdh20	UTSW	1	104,875,078 (GRCm39)	missense	possibly damaging	0.91
R7207:Cdh20	UTSW	1	104,921,702 (GRCm39)	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104,881,796 (GRCm39)	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104,898,598 (GRCm39)	missense	probably benign
R7511:Cdh20	UTSW	1	109,925,583 (GRCm39)	intron	probably benign
R7532:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R7535:Cdh20	UTSW	1	104,902,768 (GRCm39)	missense	probably damaging	1.00
R7587:Cdh20	UTSW	1	104,869,004 (GRCm39)	missense	probably damaging	1.00
R7748:Cdh20	UTSW	1	104,869,024 (GRCm39)	missense	probably damaging	1.00
R7879:Cdh20	UTSW	1	109,976,677 (GRCm39)	missense	probably benign	0.01
R7879:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R7915:Cdh20	UTSW	1	104,861,898 (GRCm39)	missense	probably benign	0.15
R7925:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
R7978:Cdh20	UTSW	1	109,921,835 (GRCm39)	start gained	probably benign
R8022:Cdh20	UTSW	1	109,988,838 (GRCm39)	missense	probably benign	0.02
R8207:Cdh20	UTSW	1	109,922,076 (GRCm39)	missense	probably damaging	1.00
R8224:Cdh20	UTSW	1	109,921,933 (GRCm39)	missense	probably benign
R8239:Cdh20	UTSW	1	110,027,832 (GRCm39)	missense	probably benign	0.11
R8257:Cdh20	UTSW	1	104,921,962 (GRCm39)	missense	probably benign	0.25
R8444:Cdh20	UTSW	1	104,898,583 (GRCm39)	missense	probably benign	0.16
R8546:Cdh20	UTSW	1	104,861,769 (GRCm39)	start gained	probably benign
R8749:Cdh20	UTSW	1	110,027,009 (GRCm39)	missense	probably damaging	1.00
R8870:Cdh20	UTSW	1	104,873,048 (GRCm39)	missense	probably damaging	0.99
R8884:Cdh20	UTSW	1	110,027,860 (GRCm39)	missense	probably damaging	1.00
R9030:Cdh20	UTSW	1	110,027,843 (GRCm39)	missense	probably benign	0.21
R9310:Cdh20	UTSW	1	104,875,061 (GRCm39)	missense	probably damaging	1.00
R9498:Cdh20	UTSW	1	109,976,635 (GRCm39)	missense	probably benign	0.03
R9542:Cdh20	UTSW	1	104,875,067 (GRCm39)	missense	probably damaging	1.00
R9602:Cdh20	UTSW	1	104,868,823 (GRCm39)	missense	probably benign	0.07
R9658:Cdh20	UTSW	1	109,988,785 (GRCm39)	missense	probably damaging	0.99
R9664:Cdh20	UTSW	1	104,862,065 (GRCm39)	missense	probably benign	0.10
Z1088:Cdh20	UTSW	1	110,012,853 (GRCm39)	missense	probably benign	0.01
Z1176:Cdh20	UTSW	1	110,036,466 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTTACAGCTGTGACATGAAAGTG -3'
(R):5'- ATGCTCCTTACTTACCTACAGGAG -3'

Sequencing Primer
(F):5'- GCTGTGACATGAAAGTGATTTTTAC -3'
(R):5'- TTACCTACAGGAGACATCTCAGG -3'

Posted On

2016-10-05