Incidental Mutation 'R0479:Trove2'
ID43233
Institutional Source Beutler Lab
Gene Symbol Trove2
Ensembl Gene ENSMUSG00000018199
Gene NameTROVE domain family, member 2
Synonyms1810007I17Rik, A530054J02Rik, SS-A/Ro, Ssa, Ssa2
MMRRC Submission 038679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R0479 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location143750790-143777068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143757751 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 536 (D536E)
Ref Sequence ENSEMBL: ENSMUSP00000125623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159879]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000018343
Predicted Effect possibly damaging
Transcript: ENSMUST00000159879
AA Change: D536E

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125623
Gene: ENSMUSG00000018199
AA Change: D536E

DomainStartEndE-ValueType
Pfam:TROVE 16 369 9.7e-99 PFAM
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 98% (105/107)
MGI Phenotype PHENOTYPE: Homozygous mutant mice develop symptoms similar to those observed in patients with lupus, including increased photosensitivity and membranoproliferative glomerulonephritis. The production of autoantibodies is detected in both homozygous and heterozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,145 V269A probably benign Het
Acsl1 G A 8: 46,531,072 G543R probably damaging Het
Adam18 T C 8: 24,651,822 N244D probably benign Het
Adgra3 C T 5: 49,990,265 V478M probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Arhgef10 A T 8: 14,991,070 E723V probably damaging Het
Arid3a C A 10: 79,951,294 N519K possibly damaging Het
Atrn T A 2: 130,999,165 Y1162* probably null Het
Cacng5 T A 11: 107,877,951 N172Y probably benign Het
Cct8 C T 16: 87,487,706 V198M probably damaging Het
Cep192 G A 18: 67,858,018 S1857N probably damaging Het
Cherp A T 8: 72,463,147 D657E possibly damaging Het
Clca2 T G 3: 145,090,849 D199A probably damaging Het
Cops7b A G 1: 86,605,076 T219A probably benign Het
Crb1 C T 1: 139,198,614 M1392I probably damaging Het
Csf3r A C 4: 126,043,823 E833D probably damaging Het
Cutc A G 19: 43,768,216 E247G probably damaging Het
Cyp2c38 A G 19: 39,463,005 L17P probably damaging Het
D430042O09Rik T C 7: 125,843,346 L809S probably benign Het
D5Ertd615e T A 5: 45,163,454 noncoding transcript Het
Ddx60 G T 8: 61,969,657 G643W probably damaging Het
Depdc1a C T 3: 159,520,860 T268I probably damaging Het
Dgke T C 11: 89,052,470 E231G probably benign Het
Dhrs7b T A 11: 60,855,687 probably benign Het
Dll3 A G 7: 28,301,549 V27A probably damaging Het
Dnmt3c T A 2: 153,714,941 probably null Het
Duox1 T C 2: 122,346,380 F1461L probably damaging Het
Enpep A G 3: 129,312,674 V301A possibly damaging Het
Eny2 T A 15: 44,435,604 probably null Het
Esr1 A G 10: 4,997,911 D488G probably damaging Het
Ets1 A G 9: 32,730,180 K110E probably damaging Het
Eya2 T A 2: 165,715,956 Y157* probably null Het
F830045P16Rik T G 2: 129,472,688 D223A possibly damaging Het
Fbxo18 A G 2: 11,758,419 Y475H probably damaging Het
Fbxo39 T C 11: 72,317,593 I257T probably damaging Het
Fkbp10 T C 11: 100,415,914 V23A probably damaging Het
Foxp3 A G X: 7,587,344 I128V possibly damaging Het
Fzd7 T C 1: 59,483,708 F250S probably damaging Het
Gaa A G 11: 119,281,236 T722A possibly damaging Het
Gemin5 A G 11: 58,139,551 V816A probably benign Het
Glb1l3 T A 9: 26,829,093 T314S probably benign Het
H2-Ab1 A G 17: 34,264,968 E101G possibly damaging Het
Hydin A C 8: 110,599,088 T4710P probably damaging Het
Ica1 C T 6: 8,754,627 V48M probably damaging Het
Ica1 T C 6: 8,754,683 Y29C probably damaging Het
Ints7 T A 1: 191,614,554 probably null Het
Iqub T C 6: 24,505,810 E33G probably benign Het
Itgb1bp2 T A X: 101,449,200 C10S probably damaging Het
Kcnd1 T A X: 7,831,222 I391N possibly damaging Het
Kdm8 T C 7: 125,452,640 L135P probably damaging Het
Ksr1 T C 11: 79,025,283 D574G probably damaging Het
Lama5 C T 2: 180,184,457 R2331H probably benign Het
Larp1 C A 11: 58,042,820 N357K possibly damaging Het
Lgi3 C T 14: 70,534,552 probably benign Het
Lmbrd1 T A 1: 24,746,797 probably benign Het
Methig1 A T 15: 100,374,944 K53* probably null Het
Mfap3 T A 11: 57,529,643 I150N probably damaging Het
Mug1 A T 6: 121,840,227 Q85L probably benign Het
Npl A G 1: 153,515,409 V200A probably damaging Het
Nuf2 A T 1: 169,498,934 probably benign Het
Obscn A G 11: 59,112,707 V1255A probably damaging Het
Olfr186 C T 16: 59,027,128 V260M possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr916 T C 9: 38,658,182 D70G probably damaging Het
P2rx1 T C 11: 73,012,961 V283A probably damaging Het
Pex2 C A 3: 5,561,295 L151F probably damaging Het
Pias1 A G 9: 62,893,118 probably benign Het
Pmfbp1 A T 8: 109,530,473 probably benign Het
Pogz A G 3: 94,876,636 K545E possibly damaging Het
Ppp3cb T C 14: 20,503,241 probably null Het
Prl G A 13: 27,064,928 D189N probably damaging Het
Prpf6 A G 2: 181,651,127 N794S probably benign Het
Prr36 G A 8: 4,213,930 Q579* probably null Het
Ptprq A T 10: 107,643,994 Y1138* probably null Het
Rabepk A T 2: 34,785,580 H179Q probably damaging Het
Rest T C 5: 77,282,751 S1006P probably damaging Het
Rimklb A C 6: 122,464,216 probably benign Het
Rnpepl1 T C 1: 92,918,865 probably benign Het
Sacs T A 14: 61,191,479 L329Q probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Setd5 A T 6: 113,115,033 I272F probably damaging Het
Sgk1 G T 10: 21,996,310 A262S probably benign Het
Skint2 G A 4: 112,624,041 V34I possibly damaging Het
Skint5 G C 4: 113,655,672 Q888E unknown Het
Slc4a3 T C 1: 75,551,828 probably benign Het
Sox10 T C 15: 79,163,319 E133G probably damaging Het
Spryd3 G A 15: 102,130,400 R129* probably null Het
Stag1 T A 9: 100,928,091 N782K probably benign Het
Stam T C 2: 14,117,495 L132P probably damaging Het
Stard9 T A 2: 120,697,596 S1445T probably damaging Het
Syt5 C T 7: 4,543,109 R94Q probably benign Het
Tbc1d23 A T 16: 57,171,814 H594Q probably damaging Het
Tecta T A 9: 42,337,939 I1871F probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Thrb T C 14: 18,033,643 F469L probably damaging Het
Tyr T C 7: 87,493,221 S44G possibly damaging Het
Usp20 T A 2: 31,017,475 V673E probably benign Het
Usp28 T C 9: 49,037,213 S873P probably damaging Het
Usp43 C T 11: 67,897,274 V306M possibly damaging Het
Wdr17 G T 8: 54,651,421 probably null Het
Wsb2 T G 5: 117,376,679 probably benign Het
Xkrx A T X: 134,150,966 L312Q probably damaging Het
Other mutations in Trove2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Trove2 APN 1 143761382 missense probably benign 0.29
IGL01578:Trove2 APN 1 143761300 missense probably damaging 0.99
IGL02006:Trove2 APN 1 143760346 splice site probably benign
IGL02155:Trove2 APN 1 143761269 critical splice donor site probably null
IGL02219:Trove2 APN 1 143761275 missense possibly damaging 0.94
IGL02637:Trove2 APN 1 143770788 missense probably damaging 1.00
IGL03013:Trove2 APN 1 143770708 missense probably damaging 1.00
IGL03075:Trove2 APN 1 143770771 missense probably benign
R0415:Trove2 UTSW 1 143760075 missense probably benign 0.00
R0443:Trove2 UTSW 1 143765923 splice site probably benign
R1696:Trove2 UTSW 1 143757837 missense probably damaging 0.99
R1728:Trove2 UTSW 1 143760014 missense probably benign
R1728:Trove2 UTSW 1 143760034 missense probably benign
R1729:Trove2 UTSW 1 143760014 missense probably benign
R1729:Trove2 UTSW 1 143760034 missense probably benign
R1730:Trove2 UTSW 1 143760014 missense probably benign
R1730:Trove2 UTSW 1 143760034 missense probably benign
R1739:Trove2 UTSW 1 143760014 missense probably benign
R1739:Trove2 UTSW 1 143760034 missense probably benign
R1762:Trove2 UTSW 1 143760014 missense probably benign
R1762:Trove2 UTSW 1 143760034 missense probably benign
R1783:Trove2 UTSW 1 143760014 missense probably benign
R1783:Trove2 UTSW 1 143760034 missense probably benign
R1784:Trove2 UTSW 1 143760014 missense probably benign
R1784:Trove2 UTSW 1 143760034 missense probably benign
R1785:Trove2 UTSW 1 143760014 missense probably benign
R1785:Trove2 UTSW 1 143760034 missense probably benign
R1857:Trove2 UTSW 1 143770750 missense probably benign 0.00
R2049:Trove2 UTSW 1 143760034 missense probably benign
R2130:Trove2 UTSW 1 143760034 missense probably benign
R2131:Trove2 UTSW 1 143760034 missense probably benign
R2133:Trove2 UTSW 1 143760034 missense probably benign
R2141:Trove2 UTSW 1 143760034 missense probably benign
R2142:Trove2 UTSW 1 143760034 missense probably benign
R2372:Trove2 UTSW 1 143770882 nonsense probably null
R2929:Trove2 UTSW 1 143757878 missense possibly damaging 0.92
R4191:Trove2 UTSW 1 143770786 missense probably benign 0.00
R5520:Trove2 UTSW 1 143770771 missense probably benign
R5821:Trove2 UTSW 1 143766765 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TAGCTGAGTACATGCACCTTTGGGC -3'
(R):5'- AATCCAGCATTTTGGTAGGAGGAACC -3'

Sequencing Primer
(F):5'- GGGCTCAACTTTTGTCTCCTTC -3'
(R):5'- AGGATTTTTTTGTTTGCTTTTCTTGC -3'
Posted On2013-05-23