Incidental Mutation 'R5496:Kcnn3'
ID 432330
Institutional Source Beutler Lab
Gene Symbol Kcnn3
Ensembl Gene ENSMUSG00000000794
Gene Name potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms small conductance calcium-activated potassium channel 3, SK3
MMRRC Submission 043057-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock # R5496 (G1)
Quality Score 217
Status Not validated
Chromosome 3
Chromosomal Location 89520164-89675132 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89609490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 402 (A402V)
Ref Sequence ENSEMBL: ENSMUSP00000000811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000811]
AlphaFold P58391
Predicted Effect possibly damaging
Transcript: ENSMUST00000000811
AA Change: A402V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794
AA Change: A402V

DomainStartEndE-ValueType
low complexity region 30 96 N/A INTRINSIC
low complexity region 139 154 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Pfam:SK_channel 270 383 3.1e-51 PFAM
Pfam:Ion_trans_2 462 548 2.2e-14 PFAM
CaMBD 562 638 1.04e-49 SMART
low complexity region 684 690 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,674,818 V84I probably benign Het
Adam10 T G 9: 70,722,739 F151C probably damaging Het
Akap6 A G 12: 53,140,653 S1617G possibly damaging Het
Ano6 T A 15: 95,967,614 probably null Het
Atmin A G 8: 116,957,172 T524A probably benign Het
Bicra C T 7: 15,987,841 V584I probably benign Het
Carmil1 G A 13: 24,155,450 R54C probably damaging Het
Cbln1 A G 8: 87,471,696 I127T possibly damaging Het
Ccl26 A G 5: 135,563,363 V40A probably benign Het
Cdh7 T A 1: 110,048,917 I104N probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col12a1 A G 9: 79,602,185 probably benign Het
Csf2rb A G 15: 78,340,561 E173G probably damaging Het
Cyb561 A G 11: 105,937,719 Y94H probably damaging Het
Cyp3a16 T A 5: 145,467,531 K34M probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah7a T G 1: 53,457,768 M3110L probably benign Het
Dyrk2 T C 10: 118,860,051 E434G probably damaging Het
Ebag9 T G 15: 44,640,420 *214E probably null Het
Egln3 A T 12: 54,203,324 W80R probably damaging Het
Eps15l1 A G 8: 72,382,775 Y336H probably benign Het
Gak A G 5: 108,576,617 S1076P probably benign Het
Glra1 T C 11: 55,527,415 Y168C probably damaging Het
Glrx2 T A 1: 143,745,207 M108K probably damaging Het
Gm3604 A T 13: 62,371,579 S59T possibly damaging Het
Gm8212 A T 14: 44,201,157 probably benign Het
Gmcl1 G T 6: 86,697,525 A457D probably damaging Het
H2-M11 T C 17: 36,547,979 F137S possibly damaging Het
Ighv1-55 C G 12: 115,208,520 W3S probably damaging Het
Il22 T G 10: 118,205,097 V36G possibly damaging Het
Ints1 G A 5: 139,755,198 A1904V probably benign Het
Iqgap2 A G 13: 95,630,053 Y1481H probably damaging Het
Kif18b A T 11: 102,913,742 I362N possibly damaging Het
Kif5c C G 2: 49,730,190 A223G possibly damaging Het
Kntc1 A G 5: 123,784,182 D948G probably benign Het
Krba1 A G 6: 48,406,356 T229A possibly damaging Het
Leprot T A 4: 101,657,896 I113N probably damaging Het
Lrp1b T C 2: 40,927,973 D2415G probably benign Het
Maats1 A G 16: 38,321,493 I359T probably damaging Het
Mnd1 T A 3: 84,088,174 D171V probably damaging Het
Mthfsd A T 8: 121,098,814 Y339* probably null Het
Nfatc2 G A 2: 168,536,278 T268M probably damaging Het
Olfr1097 G T 2: 86,890,314 P287Q probably damaging Het
Olfr1097 G C 2: 86,890,315 P287A probably damaging Het
Olfr116 T C 17: 37,624,578 D19G probably benign Het
Olfr653 G C 7: 104,580,494 A283P probably damaging Het
Pan3 G A 5: 147,527,128 probably null Het
Pde6a A T 18: 61,253,665 probably null Het
Prss39 T C 1: 34,500,261 I194T possibly damaging Het
Rfx8 T C 1: 39,670,347 S507G probably benign Het
Rif1 T C 2: 52,098,916 S774P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smurf1 C A 5: 144,882,593 E601* probably null Het
Stau2 T C 1: 16,390,021 S231G probably damaging Het
Timp2 T G 11: 118,303,881 M161L probably benign Het
Tlr5 T C 1: 182,973,632 L167P probably damaging Het
Trhr G A 15: 44,197,536 A151T probably benign Het
Unc13d A G 11: 116,066,708 V807A probably damaging Het
Usp2 T C 9: 44,085,208 V7A possibly damaging Het
Uspl1 A G 5: 149,209,779 T447A probably damaging Het
Zan A G 5: 137,436,345 I2232T unknown Het
Zfp12 C A 5: 143,244,795 C292* probably null Het
Zfp850 A C 7: 28,007,346 M43R probably damaging Het
Zic5 G A 14: 122,459,343 T620M unknown Het
Other mutations in Kcnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02263:Kcnn3 APN 3 89661218 missense possibly damaging 0.73
IGL02444:Kcnn3 APN 3 89652052 missense possibly damaging 0.50
IGL02500:Kcnn3 APN 3 89661112 splice site probably benign
IGL02814:Kcnn3 APN 3 89521175 missense possibly damaging 0.94
IGL02821:Kcnn3 APN 3 89662722 missense possibly damaging 0.84
IGL02821:Kcnn3 APN 3 89520974 missense possibly damaging 0.91
IGL02852:Kcnn3 APN 3 89609616 missense probably damaging 0.96
IGL02942:Kcnn3 APN 3 89652076 missense probably benign 0.00
IGL03118:Kcnn3 APN 3 89667161 missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89662773 missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89662773 missense probably damaging 1.00
R0032:Kcnn3 UTSW 3 89520665 small deletion probably benign
R0370:Kcnn3 UTSW 3 89667092 missense probably damaging 0.98
R0619:Kcnn3 UTSW 3 89652030 missense probably damaging 1.00
R1167:Kcnn3 UTSW 3 89564952 nonsense probably null
R1255:Kcnn3 UTSW 3 89652109 missense possibly damaging 0.84
R1643:Kcnn3 UTSW 3 89520497 missense unknown
R1733:Kcnn3 UTSW 3 89652090 missense probably benign 0.00
R1793:Kcnn3 UTSW 3 89609405 missense probably benign 0.20
R1827:Kcnn3 UTSW 3 89520994 missense possibly damaging 0.75
R1899:Kcnn3 UTSW 3 89520455 start gained probably benign
R2055:Kcnn3 UTSW 3 89521375 missense probably damaging 1.00
R2843:Kcnn3 UTSW 3 89520665 small deletion probably benign
R2922:Kcnn3 UTSW 3 89521022 missense probably damaging 1.00
R4078:Kcnn3 UTSW 3 89661188 missense possibly damaging 0.68
R4227:Kcnn3 UTSW 3 89521175 missense possibly damaging 0.94
R4604:Kcnn3 UTSW 3 89520420 start gained probably benign
R4814:Kcnn3 UTSW 3 89662724 missense probably damaging 1.00
R4822:Kcnn3 UTSW 3 89667289 missense possibly damaging 0.93
R5175:Kcnn3 UTSW 3 89609439 missense probably damaging 1.00
R5211:Kcnn3 UTSW 3 89521231 missense probably benign 0.04
R5438:Kcnn3 UTSW 3 89521298 missense probably damaging 1.00
R6244:Kcnn3 UTSW 3 89645523 nonsense probably null
R7391:Kcnn3 UTSW 3 89609471 missense probably benign 0.34
R7625:Kcnn3 UTSW 3 89609670 missense probably damaging 0.99
R7834:Kcnn3 UTSW 3 89521354 missense probably damaging 1.00
R8022:Kcnn3 UTSW 3 89609703 missense possibly damaging 0.92
R8110:Kcnn3 UTSW 3 89661233 missense probably damaging 0.99
R8220:Kcnn3 UTSW 3 89661241 missense probably benign 0.14
R8787:Kcnn3 UTSW 3 89645450 missense possibly damaging 0.93
R9124:Kcnn3 UTSW 3 89521229 missense possibly damaging 0.47
R9256:Kcnn3 UTSW 3 89667100 missense probably damaging 1.00
R9612:Kcnn3 UTSW 3 89609396 missense probably benign 0.09
Z1088:Kcnn3 UTSW 3 89667130 missense probably damaging 1.00
Z1177:Kcnn3 UTSW 3 89520923 missense probably damaging 1.00
Z1177:Kcnn3 UTSW 3 89661136 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGTGATCGACAATGGTGCAG -3'
(R):5'- CCTTTCACAGACTCGCACAG -3'

Sequencing Primer
(F):5'- TCGACAATGGTGCAGATGACTG -3'
(R):5'- ACAGTCCAGGCAGCGATGATC -3'
Posted On 2016-10-05