Incidental Mutation 'R5496:Krba1'
ID432343
Institutional Source Beutler Lab
Gene Symbol Krba1
Ensembl Gene ENSMUSG00000042810
Gene NameKRAB-A domain containing 1
SynonymsA930040G15Rik
MMRRC Submission 043057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5496 (G1)
Quality Score198
Status Not validated
Chromosome6
Chromosomal Location48395586-48419781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48406356 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 229 (T229A)
Ref Sequence ENSEMBL: ENSMUSP00000031815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031815] [ENSMUST00000077093] [ENSMUST00000114571] [ENSMUST00000114572] [ENSMUST00000203371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031815
AA Change: T229A

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031815
Gene: ENSMUSG00000042810
AA Change: T229A

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
KRBA1 154 197 1.27e-3 SMART
KRBA1 249 291 3.23e-14 SMART
KRBA1 310 355 8.27e-12 SMART
KRBA1 357 399 4.98e-6 SMART
low complexity region 452 459 N/A INTRINSIC
KRBA1 474 516 6.03e-14 SMART
KRBA1 576 619 7.71e-12 SMART
coiled coil region 814 847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077093
AA Change: T174A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076345
Gene: ENSMUSG00000042810
AA Change: T174A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 193 235 3.23e-14 SMART
KRBA1 254 299 8.27e-12 SMART
KRBA1 367 409 7.26e-8 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 6.03e-14 SMART
KRBA1 586 629 7.71e-12 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114571
AA Change: T174A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110218
Gene: ENSMUSG00000042810
AA Change: T174A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 193 235 3.23e-14 SMART
KRBA1 254 299 8.27e-12 SMART
KRBA1 367 409 7.26e-8 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 6.03e-14 SMART
KRBA1 586 629 7.71e-12 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114572
AA Change: T209A

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110219
Gene: ENSMUSG00000042810
AA Change: T209A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 194 236 3.23e-14 SMART
KRBA1 255 300 8.27e-12 SMART
KRBA1 368 410 7.26e-8 SMART
low complexity region 463 470 N/A INTRINSIC
KRBA1 485 527 6.03e-14 SMART
KRBA1 587 630 7.71e-12 SMART
coiled coil region 825 858 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154536
Predicted Effect possibly damaging
Transcript: ENSMUST00000203371
AA Change: T173A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145256
Gene: ENSMUSG00000042810
AA Change: T173A

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 97 140 8.1e-8 SMART
KRBA1 193 235 2.5e-18 SMART
KRBA1 254 299 6.4e-16 SMART
KRBA1 367 409 5.7e-12 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 4.6e-18 SMART
KRBA1 586 629 5.8e-16 SMART
coiled coil region 824 857 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,674,818 V84I probably benign Het
Adam10 T G 9: 70,722,739 F151C probably damaging Het
Akap6 A G 12: 53,140,653 S1617G possibly damaging Het
Ano6 T A 15: 95,967,614 probably null Het
Atmin A G 8: 116,957,172 T524A probably benign Het
Bicra C T 7: 15,987,841 V584I probably benign Het
Carmil1 G A 13: 24,155,450 R54C probably damaging Het
Cbln1 A G 8: 87,471,696 I127T possibly damaging Het
Ccl26 A G 5: 135,563,363 V40A probably benign Het
Cdh7 T A 1: 110,048,917 I104N probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col12a1 A G 9: 79,602,185 probably benign Het
Csf2rb A G 15: 78,340,561 E173G probably damaging Het
Cyb561 A G 11: 105,937,719 Y94H probably damaging Het
Cyp3a16 T A 5: 145,467,531 K34M probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah7a T G 1: 53,457,768 M3110L probably benign Het
Dyrk2 T C 10: 118,860,051 E434G probably damaging Het
Ebag9 T G 15: 44,640,420 *214E probably null Het
Egln3 A T 12: 54,203,324 W80R probably damaging Het
Eps15l1 A G 8: 72,382,775 Y336H probably benign Het
Gak A G 5: 108,576,617 S1076P probably benign Het
Glra1 T C 11: 55,527,415 Y168C probably damaging Het
Glrx2 T A 1: 143,745,207 M108K probably damaging Het
Gm3604 A T 13: 62,371,579 S59T possibly damaging Het
Gm8212 A T 14: 44,201,157 probably benign Het
Gmcl1 G T 6: 86,697,525 A457D probably damaging Het
H2-M11 T C 17: 36,547,979 F137S possibly damaging Het
Ighv1-55 C G 12: 115,208,520 W3S probably damaging Het
Il22 T G 10: 118,205,097 V36G possibly damaging Het
Ints1 G A 5: 139,755,198 A1904V probably benign Het
Iqgap2 A G 13: 95,630,053 Y1481H probably damaging Het
Kcnn3 C T 3: 89,609,490 A402V possibly damaging Het
Kif18b A T 11: 102,913,742 I362N possibly damaging Het
Kif5c C G 2: 49,730,190 A223G possibly damaging Het
Kntc1 A G 5: 123,784,182 D948G probably benign Het
Leprot T A 4: 101,657,896 I113N probably damaging Het
Lrp1b T C 2: 40,927,973 D2415G probably benign Het
Maats1 A G 16: 38,321,493 I359T probably damaging Het
Mnd1 T A 3: 84,088,174 D171V probably damaging Het
Mthfsd A T 8: 121,098,814 Y339* probably null Het
Nfatc2 G A 2: 168,536,278 T268M probably damaging Het
Olfr1097 G T 2: 86,890,314 P287Q probably damaging Het
Olfr1097 G C 2: 86,890,315 P287A probably damaging Het
Olfr116 T C 17: 37,624,578 D19G probably benign Het
Olfr653 G C 7: 104,580,494 A283P probably damaging Het
Pan3 G A 5: 147,527,128 probably null Het
Pde6a A T 18: 61,253,665 probably null Het
Prss39 T C 1: 34,500,261 I194T possibly damaging Het
Rfx8 T C 1: 39,670,347 S507G probably benign Het
Rif1 T C 2: 52,098,916 S774P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smurf1 C A 5: 144,882,593 E601* probably null Het
Stau2 T C 1: 16,390,021 S231G probably damaging Het
Timp2 T G 11: 118,303,881 M161L probably benign Het
Tlr5 T C 1: 182,973,632 L167P probably damaging Het
Trhr G A 15: 44,197,536 A151T probably benign Het
Unc13d A G 11: 116,066,708 V807A probably damaging Het
Usp2 T C 9: 44,085,208 V7A possibly damaging Het
Uspl1 A G 5: 149,209,779 T447A probably damaging Het
Zan A G 5: 137,436,345 I2232T unknown Het
Zfp12 C A 5: 143,244,795 C292* probably null Het
Zfp850 A C 7: 28,007,346 M43R probably damaging Het
Zic5 G A 14: 122,459,343 T620M unknown Het
Other mutations in Krba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Krba1 APN 6 48406318 missense possibly damaging 0.95
IGL01663:Krba1 APN 6 48411754 missense probably damaging 0.99
IGL01764:Krba1 APN 6 48415836 missense probably benign 0.01
IGL02036:Krba1 APN 6 48415642 missense possibly damaging 0.95
IGL02333:Krba1 APN 6 48413087 missense probably damaging 0.99
IGL02681:Krba1 APN 6 48404118 missense probably damaging 1.00
IGL03069:Krba1 APN 6 48414549 missense possibly damaging 0.53
IGL03380:Krba1 APN 6 48403453 missense possibly damaging 0.53
PIT4151001:Krba1 UTSW 6 48402897 missense probably damaging 0.99
R0077:Krba1 UTSW 6 48405225 splice site probably benign
R0504:Krba1 UTSW 6 48416254 missense probably benign 0.07
R1051:Krba1 UTSW 6 48413398 missense possibly damaging 0.82
R1875:Krba1 UTSW 6 48414049 splice site probably null
R1912:Krba1 UTSW 6 48415765 missense probably benign 0.45
R2084:Krba1 UTSW 6 48414568 missense probably damaging 1.00
R4035:Krba1 UTSW 6 48411680 missense probably damaging 1.00
R4291:Krba1 UTSW 6 48415665 missense possibly damaging 0.93
R4568:Krba1 UTSW 6 48409723 missense probably damaging 0.98
R4619:Krba1 UTSW 6 48406348 nonsense probably null
R4638:Krba1 UTSW 6 48409751 nonsense probably null
R4913:Krba1 UTSW 6 48406957 missense probably benign 0.00
R5174:Krba1 UTSW 6 48412295 missense probably damaging 1.00
R5487:Krba1 UTSW 6 48404039 missense probably damaging 1.00
R5514:Krba1 UTSW 6 48413495 missense probably damaging 1.00
R5879:Krba1 UTSW 6 48415744 missense possibly damaging 0.89
R6351:Krba1 UTSW 6 48414128 missense probably benign 0.35
R6516:Krba1 UTSW 6 48413272 nonsense probably null
R7003:Krba1 UTSW 6 48413080 missense possibly damaging 0.71
R7135:Krba1 UTSW 6 48416299 missense probably benign 0.01
R7202:Krba1 UTSW 6 48412327 missense probably damaging 1.00
R7308:Krba1 UTSW 6 48406339 missense probably benign 0.04
R7936:Krba1 UTSW 6 48411669 missense probably damaging 1.00
Z1177:Krba1 UTSW 6 48413256 missense probably damaging 1.00
Z1177:Krba1 UTSW 6 48415894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTTGGCATGAACCAGTC -3'
(R):5'- ACGTCATGGAGTTCAGTTGG -3'

Sequencing Primer
(F):5'- ATCTTCCAAAGATGGCCCTAG -3'
(R):5'- GGTGAGTGACATGACCTTCAC -3'
Posted On2016-10-05