Mutagenetix > Incidental Mutations

Incidental Mutation 'R5496:Gmcl1'

432344

Institutional Source

Beutler Lab

Gene Symbol

Gmcl1

Ensembl Gene

ENSMUSG00000001157

Gene Name

germ cell-less, spermatogenesis associated 1

Synonyms

Gcl, mglc-1, 2810049L19Rik

MMRRC Submission

043057-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.423) question?

Stock #

R5496 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86691768-86733383 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 86697525 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 457 (A457D)

Ref Sequence

ENSEMBL: ENSMUSP00000001185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001185]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001185
AA Change: A457D

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000001185
Gene: ENSMUSG00000001157
AA Change: A457D

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	63	75	N/A	INTRINSIC
BTB	106	206	3.76e-11	SMART
BACK	211	298	3.6e-3	SMART

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.1%
20x: 90.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear envelope protein that appears to be involved in spermatogenesis, either directly or by influencing genes that play a more direct role in the process. This multi-exon locus is the homolog of the mouse and drosophila germ cell-less gene but the human genome also contains a single-exon locus on chromosome 5 that contains an open reading frame capable of encoding a highly-related protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired nuclear membrane integrity in liver, endocrine pancreas, and testis. Mutant males show reduced fertility with decreased chromatin condensation and morphologically abnormal sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	G	A	5: 8,674,818	V84I	probably benign	Het
Adam10	T	G	9: 70,722,739	F151C	probably damaging	Het
Akap6	A	G	12: 53,140,653	S1617G	possibly damaging	Het
Ano6	T	A	15: 95,967,614		probably null	Het
Atmin	A	G	8: 116,957,172	T524A	probably benign	Het
Bicra	C	T	7: 15,987,841	V584I	probably benign	Het
Carmil1	G	A	13: 24,155,450	R54C	probably damaging	Het
Cbln1	A	G	8: 87,471,696	I127T	possibly damaging	Het
Ccl26	A	G	5: 135,563,363	V40A	probably benign	Het
Cdh7	T	A	1: 110,048,917	I104N	probably damaging	Het
Cdt1	C	T	8: 122,570,500	R311W	probably damaging	Het
Col12a1	A	G	9: 79,602,185		probably benign	Het
Csf2rb	A	G	15: 78,340,561	E173G	probably damaging	Het
Cyb561	A	G	11: 105,937,719	Y94H	probably damaging	Het
Cyp3a16	T	A	5: 145,467,531	K34M	probably damaging	Het
Diras2	C	T	13: 52,507,750	V174M	probably benign	Het
Dnah7a	T	G	1: 53,457,768	M3110L	probably benign	Het
Dyrk2	T	C	10: 118,860,051	E434G	probably damaging	Het
Ebag9	T	G	15: 44,640,420	*214E	probably null	Het
Egln3	A	T	12: 54,203,324	W80R	probably damaging	Het
Eps15l1	A	G	8: 72,382,775	Y336H	probably benign	Het
Gak	A	G	5: 108,576,617	S1076P	probably benign	Het
Glra1	T	C	11: 55,527,415	Y168C	probably damaging	Het
Glrx2	T	A	1: 143,745,207	M108K	probably damaging	Het
Gm3604	A	T	13: 62,371,579	S59T	possibly damaging	Het
Gm8212	A	T	14: 44,201,157		probably benign	Het
H2-M11	T	C	17: 36,547,979	F137S	possibly damaging	Het
Ighv1-55	C	G	12: 115,208,520	W3S	probably damaging	Het
Il22	T	G	10: 118,205,097	V36G	possibly damaging	Het
Ints1	G	A	5: 139,755,198	A1904V	probably benign	Het
Iqgap2	A	G	13: 95,630,053	Y1481H	probably damaging	Het
Kcnn3	C	T	3: 89,609,490	A402V	possibly damaging	Het
Kif18b	A	T	11: 102,913,742	I362N	possibly damaging	Het
Kif5c	C	G	2: 49,730,190	A223G	possibly damaging	Het
Kntc1	A	G	5: 123,784,182	D948G	probably benign	Het
Krba1	A	G	6: 48,406,356	T229A	possibly damaging	Het
Leprot	T	A	4: 101,657,896	I113N	probably damaging	Het
Lrp1b	T	C	2: 40,927,973	D2415G	probably benign	Het
Maats1	A	G	16: 38,321,493	I359T	probably damaging	Het
Mnd1	T	A	3: 84,088,174	D171V	probably damaging	Het
Mthfsd	A	T	8: 121,098,814	Y339*	probably null	Het
Nfatc2	G	A	2: 168,536,278	T268M	probably damaging	Het
Olfr1097	G	T	2: 86,890,314	P287Q	probably damaging	Het
Olfr1097	G	C	2: 86,890,315	P287A	probably damaging	Het
Olfr116	T	C	17: 37,624,578	D19G	probably benign	Het
Olfr653	G	C	7: 104,580,494	A283P	probably damaging	Het
Pan3	G	A	5: 147,527,128		probably null	Het
Pde6a	A	T	18: 61,253,665		probably null	Het
Prss39	T	C	1: 34,500,261	I194T	possibly damaging	Het
Rfx8	T	C	1: 39,670,347	S507G	probably benign	Het
Rif1	T	C	2: 52,098,916	S774P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Smurf1	C	A	5: 144,882,593	E601*	probably null	Het
Stau2	T	C	1: 16,390,021	S231G	probably damaging	Het
Timp2	T	G	11: 118,303,881	M161L	probably benign	Het
Tlr5	T	C	1: 182,973,632	L167P	probably damaging	Het
Trhr	G	A	15: 44,197,536	A151T	probably benign	Het
Unc13d	A	G	11: 116,066,708	V807A	probably damaging	Het
Usp2	T	C	9: 44,085,208	V7A	possibly damaging	Het
Uspl1	A	G	5: 149,209,779	T447A	probably damaging	Het
Zan	A	G	5: 137,436,345	I2232T	unknown	Het
Zfp12	C	A	5: 143,244,795	C292*	probably null	Het
Zfp850	A	C	7: 28,007,346	M43R	probably damaging	Het
Zic5	G	A	14: 122,459,343	T620M	unknown	Het

Other mutations in Gmcl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02015:Gmcl1	APN	6	86707457	missense	possibly damaging	0.52
IGL03354:Gmcl1	APN	6	86726158	missense	probably damaging	1.00
PIT4453001:Gmcl1	UTSW	6	86704538	missense	probably benign	0.09
R0149:Gmcl1	UTSW	6	86732909	critical splice donor site	probably null
R1398:Gmcl1	UTSW	6	86714262	splice site	probably benign
R1869:Gmcl1	UTSW	6	86697516	missense	probably benign	0.20
R1871:Gmcl1	UTSW	6	86697516	missense	probably benign	0.20
R2851:Gmcl1	UTSW	6	86726177	missense	probably damaging	0.99
R4584:Gmcl1	UTSW	6	86722623	missense	probably damaging	1.00
R4585:Gmcl1	UTSW	6	86722623	missense	probably damaging	1.00
R4664:Gmcl1	UTSW	6	86732998	missense	probably benign	0.30
R4851:Gmcl1	UTSW	6	86704556	missense	possibly damaging	0.64
R4957:Gmcl1	UTSW	6	86710521	missense	probably damaging	1.00
R5326:Gmcl1	UTSW	6	86726145	missense	possibly damaging	0.96
R5482:Gmcl1	UTSW	6	86718073	missense	probably damaging	1.00
R5817:Gmcl1	UTSW	6	86714248	missense	probably damaging	1.00
R5854:Gmcl1	UTSW	6	86714259	splice site	silent
R5891:Gmcl1	UTSW	6	86707443	missense	probably damaging	1.00
R5895:Gmcl1	UTSW	6	86711614	missense	probably benign	0.03
R6012:Gmcl1	UTSW	6	86721412	missense	probably damaging	1.00
R6257:Gmcl1	UTSW	6	86700641	missense	possibly damaging	0.82
R7693:Gmcl1	UTSW	6	86714257	missense	probably benign	0.10
R7698:Gmcl1	UTSW	6	86707415	missense	probably benign	0.00
R7999:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8049:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8093:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8109:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8110:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8111:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8154:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8157:Gmcl1	UTSW	6	86721426	missense	probably damaging	1.00
R8208:Gmcl1	UTSW	6	86721399	missense	probably damaging	0.99
R8250:Gmcl1	UTSW	6	86721402	missense	possibly damaging	0.72
R8509:Gmcl1	UTSW	6	86722607	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTTAGGAGCATCAGAGACTGC -3'
(R):5'- CCCTTTAAGGCCCTTTACAAAG -3'

Sequencing Primer
(F):5'- TAGGAGCATCAGAGACTGCAAACAC -3'
(R):5'- AAAGGACTCACTTTCTGCGG -3'

Posted On

2016-10-05