Incidental Mutation 'R5496:Eps15l1'
ID432350
Institutional Source Beutler Lab
Gene Symbol Eps15l1
Ensembl Gene ENSMUSG00000006276
Gene Nameepidermal growth factor receptor pathway substrate 15-like 1
Synonyms9830147J04Rik, Eps15-rs, Eps15R
MMRRC Submission 043057-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R5496 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72340999-72421460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72382775 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 336 (Y336H)
Ref Sequence ENSEMBL: ENSMUSP00000148484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163643] [ENSMUST00000212121] [ENSMUST00000212590]
Predicted Effect probably benign
Transcript: ENSMUST00000163643
AA Change: Y336H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129739
Gene: ENSMUSG00000006276
AA Change: Y336H

DomainStartEndE-ValueType
EH 8 103 1.45e-21 SMART
EFh 52 80 6.56e0 SMART
EH 120 214 6.1e-47 SMART
EFh 163 191 4.35e-2 SMART
low complexity region 241 255 N/A INTRINSIC
EH 266 362 5.08e-44 SMART
EFh 276 304 1.09e0 SMART
coiled coil region 381 564 N/A INTRINSIC
internal_repeat_2 615 656 1.56e-6 PROSPERO
low complexity region 661 678 N/A INTRINSIC
low complexity region 701 722 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
low complexity region 775 790 N/A INTRINSIC
internal_repeat_2 809 839 1.56e-6 PROSPERO
low complexity region 840 853 N/A INTRINSIC
UIM 863 882 3.98e1 SMART
UIM 889 907 3.76e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212121
AA Change: Y336H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212590
AA Change: Y336H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212950
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,674,818 V84I probably benign Het
Adam10 T G 9: 70,722,739 F151C probably damaging Het
Akap6 A G 12: 53,140,653 S1617G possibly damaging Het
Ano6 T A 15: 95,967,614 probably null Het
Atmin A G 8: 116,957,172 T524A probably benign Het
Bicra C T 7: 15,987,841 V584I probably benign Het
Carmil1 G A 13: 24,155,450 R54C probably damaging Het
Cbln1 A G 8: 87,471,696 I127T possibly damaging Het
Ccl26 A G 5: 135,563,363 V40A probably benign Het
Cdh7 T A 1: 110,048,917 I104N probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col12a1 A G 9: 79,602,185 probably benign Het
Csf2rb A G 15: 78,340,561 E173G probably damaging Het
Cyb561 A G 11: 105,937,719 Y94H probably damaging Het
Cyp3a16 T A 5: 145,467,531 K34M probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah7a T G 1: 53,457,768 M3110L probably benign Het
Dyrk2 T C 10: 118,860,051 E434G probably damaging Het
Ebag9 T G 15: 44,640,420 *214E probably null Het
Egln3 A T 12: 54,203,324 W80R probably damaging Het
Gak A G 5: 108,576,617 S1076P probably benign Het
Glra1 T C 11: 55,527,415 Y168C probably damaging Het
Glrx2 T A 1: 143,745,207 M108K probably damaging Het
Gm3604 A T 13: 62,371,579 S59T possibly damaging Het
Gm8212 A T 14: 44,201,157 probably benign Het
Gmcl1 G T 6: 86,697,525 A457D probably damaging Het
H2-M11 T C 17: 36,547,979 F137S possibly damaging Het
Ighv1-55 C G 12: 115,208,520 W3S probably damaging Het
Il22 T G 10: 118,205,097 V36G possibly damaging Het
Ints1 G A 5: 139,755,198 A1904V probably benign Het
Iqgap2 A G 13: 95,630,053 Y1481H probably damaging Het
Kcnn3 C T 3: 89,609,490 A402V possibly damaging Het
Kif18b A T 11: 102,913,742 I362N possibly damaging Het
Kif5c C G 2: 49,730,190 A223G possibly damaging Het
Kntc1 A G 5: 123,784,182 D948G probably benign Het
Krba1 A G 6: 48,406,356 T229A possibly damaging Het
Leprot T A 4: 101,657,896 I113N probably damaging Het
Lrp1b T C 2: 40,927,973 D2415G probably benign Het
Maats1 A G 16: 38,321,493 I359T probably damaging Het
Mnd1 T A 3: 84,088,174 D171V probably damaging Het
Mthfsd A T 8: 121,098,814 Y339* probably null Het
Nfatc2 G A 2: 168,536,278 T268M probably damaging Het
Olfr1097 G T 2: 86,890,314 P287Q probably damaging Het
Olfr1097 G C 2: 86,890,315 P287A probably damaging Het
Olfr116 T C 17: 37,624,578 D19G probably benign Het
Olfr653 G C 7: 104,580,494 A283P probably damaging Het
Pan3 G A 5: 147,527,128 probably null Het
Pde6a A T 18: 61,253,665 probably null Het
Prss39 T C 1: 34,500,261 I194T possibly damaging Het
Rfx8 T C 1: 39,670,347 S507G probably benign Het
Rif1 T C 2: 52,098,916 S774P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smurf1 C A 5: 144,882,593 E601* probably null Het
Stau2 T C 1: 16,390,021 S231G probably damaging Het
Timp2 T G 11: 118,303,881 M161L probably benign Het
Tlr5 T C 1: 182,973,632 L167P probably damaging Het
Trhr G A 15: 44,197,536 A151T probably benign Het
Unc13d A G 11: 116,066,708 V807A probably damaging Het
Usp2 T C 9: 44,085,208 V7A possibly damaging Het
Uspl1 A G 5: 149,209,779 T447A probably damaging Het
Zan A G 5: 137,436,345 I2232T unknown Het
Zfp12 C A 5: 143,244,795 C292* probably null Het
Zfp850 A C 7: 28,007,346 M43R probably damaging Het
Zic5 G A 14: 122,459,343 T620M unknown Het
Other mutations in Eps15l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Eps15l1 APN 8 72384838 nonsense probably null
IGL01316:Eps15l1 APN 8 72389414 missense possibly damaging 0.66
IGL01344:Eps15l1 APN 8 72382325 critical splice donor site probably null
IGL01918:Eps15l1 APN 8 72367912 missense possibly damaging 0.49
IGL01982:Eps15l1 APN 8 72379075 missense probably benign 0.28
IGL02305:Eps15l1 APN 8 72387009 missense probably null 1.00
IGL02939:Eps15l1 APN 8 72384762 splice site probably benign
IGL02951:Eps15l1 APN 8 72358396 missense probably benign 0.19
R0025:Eps15l1 UTSW 8 72381497 splice site probably benign
R0025:Eps15l1 UTSW 8 72381497 splice site probably benign
R0030:Eps15l1 UTSW 8 72373050 missense probably benign 0.03
R0030:Eps15l1 UTSW 8 72373050 missense probably benign 0.03
R0799:Eps15l1 UTSW 8 72346085 missense probably damaging 0.99
R1300:Eps15l1 UTSW 8 72391902 missense probably damaging 0.99
R2131:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R2132:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R2133:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R3693:Eps15l1 UTSW 8 72399060 splice site probably benign
R4072:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4074:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4076:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4485:Eps15l1 UTSW 8 72399687 missense possibly damaging 0.78
R4592:Eps15l1 UTSW 8 72341394 missense probably damaging 0.96
R4606:Eps15l1 UTSW 8 72373916 missense possibly damaging 0.69
R4981:Eps15l1 UTSW 8 72378989 critical splice donor site probably null
R5502:Eps15l1 UTSW 8 72378992 intron probably null
R5682:Eps15l1 UTSW 8 72371748 nonsense probably null
R6326:Eps15l1 UTSW 8 72341434 nonsense probably null
R6384:Eps15l1 UTSW 8 72368710 critical splice donor site probably null
R7305:Eps15l1 UTSW 8 72373034 missense probably benign
R7500:Eps15l1 UTSW 8 72382790 missense probably damaging 1.00
Z1088:Eps15l1 UTSW 8 72386901 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTGGCCCAATCAAAGGATC -3'
(R):5'- TCCTTAAGGAAGTGCTCATCAGC -3'

Sequencing Primer
(F):5'- CAAACGTGGCCTGGAGACTG -3'
(R):5'- TGGGAACATGGAGGCAGTGC -3'
Posted On2016-10-05