Mutagenetix > Incidental Mutations

Incidental Mutation 'R5496:Carmil1'

432369

Institutional Source

Beutler Lab

Gene Symbol

Carmil1

Ensembl Gene

ENSMUSG00000021338

Gene Name

capping protein regulator and myosin 1 linker 1

Synonyms

1110037D04Rik, Lrrc16, Lrrc16a, Carmil

MMRRC Submission

043057-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5496 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24012344-24280795 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24155450 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 54 (R54C)

Ref Sequence

ENSEMBL: ENSMUSP00000127121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072889] [ENSMUST00000110398] [ENSMUST00000140042]

Predicted Effect

probably damaging
Transcript: ENSMUST00000072889
AA Change: R137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072662
Gene: ENSMUSG00000021338
AA Change: R137C

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
LRR	245	272	2.42e1	SMART
LRR	275	302	1.04e1	SMART
LRR	304	331	3.1e0	SMART
LRR	336	363	5.66e1	SMART
Blast:LRR	423	450	9e-8	BLAST
Blast:LRR	451	484	7e-9	BLAST
LRR	574	601	8.81e-2	SMART
Blast:LRR	602	629	6e-10	BLAST
low complexity region	745	758	N/A	INTRINSIC
Pfam:CARMIL_C	790	1083	1.1e-101	PFAM
low complexity region	1131	1147	N/A	INTRINSIC
low complexity region	1245	1251	N/A	INTRINSIC
low complexity region	1253	1268	N/A	INTRINSIC
low complexity region	1287	1296	N/A	INTRINSIC
low complexity region	1317	1332	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110398
AA Change: R137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106028
Gene: ENSMUSG00000021338
AA Change: R137C

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
LRR	245	272	2.42e1	SMART
LRR	275	302	1.04e1	SMART
LRR	304	331	3.1e0	SMART
LRR	336	363	5.66e1	SMART
Blast:LRR	423	450	9e-8	BLAST
LRR	451	480	3.15e1	SMART
Pfam:LRR_6	481	507	1.9e-2	PFAM
LRR	570	597	8.81e-2	SMART
Blast:LRR	598	625	6e-10	BLAST
low complexity region	741	754	N/A	INTRINSIC
low complexity region	879	888	N/A	INTRINSIC
PDB:3LK3\|T	964	1076	1e-56	PDB
low complexity region	1127	1143	N/A	INTRINSIC
low complexity region	1241	1247	N/A	INTRINSIC
low complexity region	1249	1264	N/A	INTRINSIC
low complexity region	1283	1292	N/A	INTRINSIC
low complexity region	1313	1325	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125420

Predicted Effect

probably damaging
Transcript: ENSMUST00000140042
AA Change: R54C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127121
Gene: ENSMUSG00000021338
AA Change: R54C

Domain	Start	End	E-Value	Type
PDB:4K17\|D	1	58	3e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144159

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.1%
20x: 90.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	G	A	5: 8,674,818	V84I	probably benign	Het
Adam10	T	G	9: 70,722,739	F151C	probably damaging	Het
Akap6	A	G	12: 53,140,653	S1617G	possibly damaging	Het
Ano6	T	A	15: 95,967,614		probably null	Het
Atmin	A	G	8: 116,957,172	T524A	probably benign	Het
Bicra	C	T	7: 15,987,841	V584I	probably benign	Het
Cbln1	A	G	8: 87,471,696	I127T	possibly damaging	Het
Ccl26	A	G	5: 135,563,363	V40A	probably benign	Het
Cdh7	T	A	1: 110,048,917	I104N	probably damaging	Het
Cdt1	C	T	8: 122,570,500	R311W	probably damaging	Het
Col12a1	A	G	9: 79,602,185		probably benign	Het
Csf2rb	A	G	15: 78,340,561	E173G	probably damaging	Het
Cyb561	A	G	11: 105,937,719	Y94H	probably damaging	Het
Cyp3a16	T	A	5: 145,467,531	K34M	probably damaging	Het
Diras2	C	T	13: 52,507,750	V174M	probably benign	Het
Dnah7a	T	G	1: 53,457,768	M3110L	probably benign	Het
Dyrk2	T	C	10: 118,860,051	E434G	probably damaging	Het
Ebag9	T	G	15: 44,640,420	*214E	probably null	Het
Egln3	A	T	12: 54,203,324	W80R	probably damaging	Het
Eps15l1	A	G	8: 72,382,775	Y336H	probably benign	Het
Gak	A	G	5: 108,576,617	S1076P	probably benign	Het
Glra1	T	C	11: 55,527,415	Y168C	probably damaging	Het
Glrx2	T	A	1: 143,745,207	M108K	probably damaging	Het
Gm3604	A	T	13: 62,371,579	S59T	possibly damaging	Het
Gm8212	A	T	14: 44,201,157		probably benign	Het
Gmcl1	G	T	6: 86,697,525	A457D	probably damaging	Het
H2-M11	T	C	17: 36,547,979	F137S	possibly damaging	Het
Ighv1-55	C	G	12: 115,208,520	W3S	probably damaging	Het
Il22	T	G	10: 118,205,097	V36G	possibly damaging	Het
Ints1	G	A	5: 139,755,198	A1904V	probably benign	Het
Iqgap2	A	G	13: 95,630,053	Y1481H	probably damaging	Het
Kcnn3	C	T	3: 89,609,490	A402V	possibly damaging	Het
Kif18b	A	T	11: 102,913,742	I362N	possibly damaging	Het
Kif5c	C	G	2: 49,730,190	A223G	possibly damaging	Het
Kntc1	A	G	5: 123,784,182	D948G	probably benign	Het
Krba1	A	G	6: 48,406,356	T229A	possibly damaging	Het
Leprot	T	A	4: 101,657,896	I113N	probably damaging	Het
Lrp1b	T	C	2: 40,927,973	D2415G	probably benign	Het
Maats1	A	G	16: 38,321,493	I359T	probably damaging	Het
Mnd1	T	A	3: 84,088,174	D171V	probably damaging	Het
Mthfsd	A	T	8: 121,098,814	Y339*	probably null	Het
Nfatc2	G	A	2: 168,536,278	T268M	probably damaging	Het
Olfr1097	G	T	2: 86,890,314	P287Q	probably damaging	Het
Olfr1097	G	C	2: 86,890,315	P287A	probably damaging	Het
Olfr116	T	C	17: 37,624,578	D19G	probably benign	Het
Olfr653	G	C	7: 104,580,494	A283P	probably damaging	Het
Pan3	G	A	5: 147,527,128		probably null	Het
Pde6a	A	T	18: 61,253,665		probably null	Het
Prss39	T	C	1: 34,500,261	I194T	possibly damaging	Het
Rfx8	T	C	1: 39,670,347	S507G	probably benign	Het
Rif1	T	C	2: 52,098,916	S774P	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Smurf1	C	A	5: 144,882,593	E601*	probably null	Het
Stau2	T	C	1: 16,390,021	S231G	probably damaging	Het
Timp2	T	G	11: 118,303,881	M161L	probably benign	Het
Tlr5	T	C	1: 182,973,632	L167P	probably damaging	Het
Trhr	G	A	15: 44,197,536	A151T	probably benign	Het
Unc13d	A	G	11: 116,066,708	V807A	probably damaging	Het
Usp2	T	C	9: 44,085,208	V7A	possibly damaging	Het
Uspl1	A	G	5: 149,209,779	T447A	probably damaging	Het
Zan	A	G	5: 137,436,345	I2232T	unknown	Het
Zfp12	C	A	5: 143,244,795	C292*	probably null	Het
Zfp850	A	C	7: 28,007,346	M43R	probably damaging	Het
Zic5	G	A	14: 122,459,343	T620M	unknown	Het

Other mutations in Carmil1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Carmil1	APN	13	24111838	missense	possibly damaging	0.68
IGL00392:Carmil1	APN	13	24094491	missense	probably damaging	1.00
IGL00943:Carmil1	APN	13	24111886	missense	possibly damaging	0.48
IGL01375:Carmil1	APN	13	24094471	missense	possibly damaging	0.88
IGL02043:Carmil1	APN	13	24024316	unclassified	probably benign
IGL02122:Carmil1	APN	13	24036558	missense	possibly damaging	0.95
IGL02178:Carmil1	APN	13	24094403	missense	probably damaging	1.00
IGL02264:Carmil1	APN	13	24075716	missense	possibly damaging	0.95
IGL02269:Carmil1	APN	13	24155410	nonsense	probably null
IGL02546:Carmil1	APN	13	24115499	missense	probably damaging	0.98
IGL02740:Carmil1	APN	13	24094518	missense	probably damaging	0.98
IGL02876:Carmil1	APN	13	24154668	unclassified	probably benign
IGL02976:Carmil1	APN	13	24092551	missense	possibly damaging	0.96
IGL03012:Carmil1	APN	13	24036372	missense	probably benign	0.19
IGL03107:Carmil1	APN	13	24094455	missense	probably damaging	0.99
H8562:Carmil1	UTSW	13	24064647	missense	probably benign	0.00
R0085:Carmil1	UTSW	13	24025867	missense	probably benign
R0119:Carmil1	UTSW	13	24082020	missense	probably damaging	0.98
R0166:Carmil1	UTSW	13	24099049	missense	probably damaging	1.00
R0299:Carmil1	UTSW	13	24082020	missense	probably damaging	0.98
R0304:Carmil1	UTSW	13	24139341	missense	probably damaging	0.99
R0335:Carmil1	UTSW	13	24073983	missense	probably damaging	1.00
R0369:Carmil1	UTSW	13	24082020	missense	probably damaging	0.98
R0462:Carmil1	UTSW	13	24022511	missense	probably benign	0.01
R1203:Carmil1	UTSW	13	24099006	missense	probably damaging	1.00
R1540:Carmil1	UTSW	13	24099054	missense	possibly damaging	0.92
R1730:Carmil1	UTSW	13	24041689	missense	probably damaging	1.00
R1770:Carmil1	UTSW	13	24173674	missense	probably damaging	1.00
R1831:Carmil1	UTSW	13	24164879	missense	probably benign	0.00
R1893:Carmil1	UTSW	13	24024463	missense	possibly damaging	0.72
R2099:Carmil1	UTSW	13	24173667	missense	probably benign	0.00
R2153:Carmil1	UTSW	13	24141673	missense	probably damaging	0.97
R2296:Carmil1	UTSW	13	24115509	missense	probably damaging	1.00
R2869:Carmil1	UTSW	13	24045068	synonymous	silent
R2872:Carmil1	UTSW	13	24045068	synonymous	silent
R3113:Carmil1	UTSW	13	24069757	missense	probably benign	0.22
R3508:Carmil1	UTSW	13	24019676	utr 3 prime	probably benign
R3780:Carmil1	UTSW	13	24137169	missense	probably damaging	0.99
R3954:Carmil1	UTSW	13	24013407	missense	probably benign	0.00
R4027:Carmil1	UTSW	13	24067223	splice site	probably benign
R4086:Carmil1	UTSW	13	24024461	missense	possibly damaging	0.56
R4647:Carmil1	UTSW	13	24137179	missense	probably damaging	1.00
R4792:Carmil1	UTSW	13	24067190	missense	probably damaging	1.00
R4792:Carmil1	UTSW	13	24141676	missense	possibly damaging	0.96
R5012:Carmil1	UTSW	13	24024420	missense	possibly damaging	0.81
R5166:Carmil1	UTSW	13	24154983	critical splice donor site	probably null
R5199:Carmil1	UTSW	13	24111870	missense	probably damaging	1.00
R5330:Carmil1	UTSW	13	24025946	splice site	probably null
R5472:Carmil1	UTSW	13	24155471	missense	probably damaging	0.97
R5478:Carmil1	UTSW	13	24112045	missense	probably damaging	1.00
R5775:Carmil1	UTSW	13	24276537	missense	probably benign
R5789:Carmil1	UTSW	13	24121848	missense	probably damaging	1.00
R5794:Carmil1	UTSW	13	24092550	missense	probably damaging	1.00
R5977:Carmil1	UTSW	13	24069736	missense	probably damaging	1.00
R6127:Carmil1	UTSW	13	24036352	missense	probably benign	0.03
R6128:Carmil1	UTSW	13	24013194	nonsense	probably null
R6403:Carmil1	UTSW	13	24081967	missense	probably damaging	1.00
R6450:Carmil1	UTSW	13	24036564	missense	probably damaging	0.98
R6451:Carmil1	UTSW	13	24092558	nonsense	probably null
R6684:Carmil1	UTSW	13	24022542	missense	unknown
R6891:Carmil1	UTSW	13	24141723	missense	probably benign	0.13
R6902:Carmil1	UTSW	13	24115545	missense	possibly damaging	0.79
R6924:Carmil1	UTSW	13	24075684	nonsense	probably null
R6946:Carmil1	UTSW	13	24115545	missense	possibly damaging	0.79
R7038:Carmil1	UTSW	13	24139335	missense	probably damaging	1.00
R7179:Carmil1	UTSW	13	24020069	missense	probably benign	0.00
R7282:Carmil1	UTSW	13	24013404	missense	probably benign
R7286:Carmil1	UTSW	13	24013394	missense	probably damaging	0.96
R7397:Carmil1	UTSW	13	24044311	missense	probably damaging	0.99
R7412:Carmil1	UTSW	13	24098810	missense	possibly damaging	0.50
R7611:Carmil1	UTSW	13	24013332	missense	probably benign	0.30
R7642:Carmil1	UTSW	13	24067206	missense	probably benign	0.12
R7827:Carmil1	UTSW	13	24036438	missense	probably benign	0.00
R7890:Carmil1	UTSW	13	24013232	missense
R8014:Carmil1	UTSW	13	24036321	missense	possibly damaging	0.71
R8068:Carmil1	UTSW	13	24075728	missense	probably benign	0.00
R8361:Carmil1	UTSW	13	24067130	critical splice donor site	probably null
R8469:Carmil1	UTSW	13	24112028	missense	probably damaging	1.00
X0025:Carmil1	UTSW	13	24099043	missense	possibly damaging	0.47
Z1088:Carmil1	UTSW	13	24044182	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGGCTTAAATATAGGACTTCTGTC -3'
(R):5'- GCAAGTCAAAGAATAGTTTTGGCTG -3'

Sequencing Primer
(F):5'- TGTCCACCAATCTAAAGTCTGCATG -3'
(R):5'- GCTGTAGTTGAAGTGACACCCATC -3'

Posted On

2016-10-05