Incidental Mutation 'R5496:Ano6'
ID432381
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
MMRRC Submission 043057-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R5496 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 95967614 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect probably null
Transcript: ENSMUST00000071874
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227151
Predicted Effect probably null
Transcript: ENSMUST00000227791
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,674,818 V84I probably benign Het
Adam10 T G 9: 70,722,739 F151C probably damaging Het
Akap6 A G 12: 53,140,653 S1617G possibly damaging Het
Atmin A G 8: 116,957,172 T524A probably benign Het
Bicra C T 7: 15,987,841 V584I probably benign Het
Carmil1 G A 13: 24,155,450 R54C probably damaging Het
Cbln1 A G 8: 87,471,696 I127T possibly damaging Het
Ccl26 A G 5: 135,563,363 V40A probably benign Het
Cdh7 T A 1: 110,048,917 I104N probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col12a1 A G 9: 79,602,185 probably benign Het
Csf2rb A G 15: 78,340,561 E173G probably damaging Het
Cyb561 A G 11: 105,937,719 Y94H probably damaging Het
Cyp3a16 T A 5: 145,467,531 K34M probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah7a T G 1: 53,457,768 M3110L probably benign Het
Dyrk2 T C 10: 118,860,051 E434G probably damaging Het
Ebag9 T G 15: 44,640,420 *214E probably null Het
Egln3 A T 12: 54,203,324 W80R probably damaging Het
Eps15l1 A G 8: 72,382,775 Y336H probably benign Het
Gak A G 5: 108,576,617 S1076P probably benign Het
Glra1 T C 11: 55,527,415 Y168C probably damaging Het
Glrx2 T A 1: 143,745,207 M108K probably damaging Het
Gm3604 A T 13: 62,371,579 S59T possibly damaging Het
Gm8212 A T 14: 44,201,157 probably benign Het
Gmcl1 G T 6: 86,697,525 A457D probably damaging Het
H2-M11 T C 17: 36,547,979 F137S possibly damaging Het
Ighv1-55 C G 12: 115,208,520 W3S probably damaging Het
Il22 T G 10: 118,205,097 V36G possibly damaging Het
Ints1 G A 5: 139,755,198 A1904V probably benign Het
Iqgap2 A G 13: 95,630,053 Y1481H probably damaging Het
Kcnn3 C T 3: 89,609,490 A402V possibly damaging Het
Kif18b A T 11: 102,913,742 I362N possibly damaging Het
Kif5c C G 2: 49,730,190 A223G possibly damaging Het
Kntc1 A G 5: 123,784,182 D948G probably benign Het
Krba1 A G 6: 48,406,356 T229A possibly damaging Het
Leprot T A 4: 101,657,896 I113N probably damaging Het
Lrp1b T C 2: 40,927,973 D2415G probably benign Het
Maats1 A G 16: 38,321,493 I359T probably damaging Het
Mnd1 T A 3: 84,088,174 D171V probably damaging Het
Mthfsd A T 8: 121,098,814 Y339* probably null Het
Nfatc2 G A 2: 168,536,278 T268M probably damaging Het
Olfr1097 G T 2: 86,890,314 P287Q probably damaging Het
Olfr1097 G C 2: 86,890,315 P287A probably damaging Het
Olfr116 T C 17: 37,624,578 D19G probably benign Het
Olfr653 G C 7: 104,580,494 A283P probably damaging Het
Pan3 G A 5: 147,527,128 probably null Het
Pde6a A T 18: 61,253,665 probably null Het
Prss39 T C 1: 34,500,261 I194T possibly damaging Het
Rfx8 T C 1: 39,670,347 S507G probably benign Het
Rif1 T C 2: 52,098,916 S774P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smurf1 C A 5: 144,882,593 E601* probably null Het
Stau2 T C 1: 16,390,021 S231G probably damaging Het
Timp2 T G 11: 118,303,881 M161L probably benign Het
Tlr5 T C 1: 182,973,632 L167P probably damaging Het
Trhr G A 15: 44,197,536 A151T probably benign Het
Unc13d A G 11: 116,066,708 V807A probably damaging Het
Usp2 T C 9: 44,085,208 V7A possibly damaging Het
Uspl1 A G 5: 149,209,779 T447A probably damaging Het
Zan A G 5: 137,436,345 I2232T unknown Het
Zfp12 C A 5: 143,244,795 C292* probably null Het
Zfp850 A C 7: 28,007,346 M43R probably damaging Het
Zic5 G A 14: 122,459,343 T620M unknown Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1086:Ano6 UTSW 15 95949962 splice site probably null
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1494:Ano6 UTSW 15 95972507 missense probably damaging 0.98
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3717:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95962169 missense probably damaging 1.00
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R5937:Ano6 UTSW 15 95913957 missense probably damaging 0.98
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6734:Ano6 UTSW 15 95949536 missense probably damaging 0.99
R6830:Ano6 UTSW 15 95894461 missense probably damaging 1.00
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7944:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7954:Ano6 UTSW 15 95965821 missense possibly damaging 0.93
R8496:Ano6 UTSW 15 95949926 missense probably damaging 1.00
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGACATGTCCTGTTTTACCCAG -3'
(R):5'- GATGGCTTACGAATGTGCACG -3'

Sequencing Primer
(F):5'- CTGCTTCCATGCTCAATAAGATAG -3'
(R):5'- GCTTACGAATGTGCACGACCATAG -3'
Posted On2016-10-05