Incidental Mutation 'R5497:Gja8'
ID432396
Institutional Source Beutler Lab
Gene Symbol Gja8
Ensembl Gene ENSMUSG00000049908
Gene Namegap junction protein, alpha 8
SynonymsCx50, Cnx50, alpha 8 connexin, connexin 50, Lop10, Aey5
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96913566-96926020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96920197 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 50 (S50P)
Ref Sequence ENSEMBL: ENSMUSP00000049532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062944] [ENSMUST00000199597]
Predicted Effect probably damaging
Transcript: ENSMUST00000062944
AA Change: S50P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049532
Gene: ENSMUSG00000049908
AA Change: S50P

DomainStartEndE-ValueType
CNX 43 76 1.76e-20 SMART
low complexity region 134 147 N/A INTRINSIC
Connexin_CCC 168 234 2.8e-41 SMART
Pfam:Connexin50 267 333 7.3e-35 PFAM
low complexity region 337 355 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199597
SMART Domains Protein: ENSMUSP00000143542
Gene: ENSMUSG00000057123

DomainStartEndE-ValueType
CNX 43 76 3.47e-19 SMART
Connexin_CCC 163 229 2.45e-37 SMART
Pfam:Connexin40_C 257 358 2.4e-33 PFAM
Meta Mutation Damage Score 0.7408 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane connexin protein that is necessary for lens growth and maturation of lens fiber cells. The encoded protein is a component of gap junction channels and functions in a calcium and pH-dependent manner. Mutations in this gene have been associated with zonular pulverulent cataracts, nuclear progressive cataracts, and cataract-microcornea syndrome. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants exhibit microphthalmia, with small lenses and nuclear or total cataracts. Heterozygotes may be equally or less affected, depending on the particular mutation and the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Gja8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Gja8 APN 3 96919242 missense probably benign
IGL02114:Gja8 APN 3 96920025 missense probably benign 0.00
IGL02237:Gja8 APN 3 96919933 missense probably benign 0.00
IGL03204:Gja8 APN 3 96920092 missense probably damaging 1.00
L1 UTSW 3 96920197 missense probably damaging 1.00
R1024:Gja8 UTSW 3 96919424 missense probably benign 0.00
R2215:Gja8 UTSW 3 96919902 missense probably damaging 0.98
R2240:Gja8 UTSW 3 96920302 missense probably benign 0.05
R2510:Gja8 UTSW 3 96919717 missense probably damaging 1.00
R2511:Gja8 UTSW 3 96919717 missense probably damaging 1.00
R2926:Gja8 UTSW 3 96919153 missense probably benign 0.00
R3725:Gja8 UTSW 3 96919845 missense probably damaging 1.00
R4090:Gja8 UTSW 3 96919152 missense probably benign 0.00
R4933:Gja8 UTSW 3 96919035 intron probably benign
R5010:Gja8 UTSW 3 96919849 missense probably benign 0.24
R5532:Gja8 UTSW 3 96920332 missense probably benign 0.39
R6997:Gja8 UTSW 3 96919341 missense probably benign
R7381:Gja8 UTSW 3 96920022 missense probably benign
R7576:Gja8 UTSW 3 96919893 missense probably benign 0.05
R7792:Gja8 UTSW 3 96919776 missense probably damaging 1.00
R7827:Gja8 UTSW 3 96920319 missense possibly damaging 0.52
Z1177:Gja8 UTSW 3 96920236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCCTCCATGCGAACGTG -3'
(R):5'- GTCACTCCAAGAGCTAGGAAAG -3'

Sequencing Primer
(F):5'- ATGCGAACGTGGTGTACC -3'
(R):5'- GAGATCATCTCAGAGTTGCACTG -3'
Posted On2016-10-05