Incidental Mutation 'R5497:Asap3'
ID432399
Institutional Source Beutler Lab
Gene Symbol Asap3
Ensembl Gene ENSMUSG00000036995
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 3
SynonymsUPLC1, 9430088F20Rik, Ddefl1
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136206365-136245216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136239222 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 537 (H537R)
Ref Sequence ENSEMBL: ENSMUSP00000041899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047526]
Predicted Effect probably benign
Transcript: ENSMUST00000047526
AA Change: H537R

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041899
Gene: ENSMUSG00000036995
AA Change: H537R

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
Pfam:BAR_3 32 264 5.5e-20 PFAM
PH 303 396 5.61e-17 SMART
ArfGap 425 547 8.33e-31 SMART
ANK 584 616 4.86e1 SMART
ANK 620 649 3.06e-5 SMART
low complexity region 794 806 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of ADP-ribosylation factor(Arf) GTPase-activating proteins that contain additional ankyrin repeat and pleckstrin homology domains. The Arf GAP domain of this protein catalyzes the hydrolysis of GTP bound to Arf proteins. The encoded protein promotes cell differentiation and migration and has been implicated in cancer cell invasion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Asap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Asap3 APN 4 136206568 missense probably damaging 1.00
IGL01865:Asap3 APN 4 136236404 missense probably damaging 1.00
IGL02045:Asap3 APN 4 136227441 missense probably benign 0.01
IGL02105:Asap3 APN 4 136228474 critical splice donor site probably null
IGL02135:Asap3 APN 4 136241153 critical splice acceptor site probably null
IGL02484:Asap3 APN 4 136229457 splice site probably benign
IGL02524:Asap3 APN 4 136238616 missense probably damaging 1.00
IGL02881:Asap3 APN 4 136239237 missense probably benign 0.00
R0128:Asap3 UTSW 4 136234604 missense probably damaging 0.99
R0883:Asap3 UTSW 4 136234325 splice site probably benign
R0903:Asap3 UTSW 4 136238376 missense probably benign
R1073:Asap3 UTSW 4 136236431 missense probably damaging 1.00
R1498:Asap3 UTSW 4 136239194 missense probably benign
R1951:Asap3 UTSW 4 136227456 nonsense probably null
R1953:Asap3 UTSW 4 136227456 nonsense probably null
R3703:Asap3 UTSW 4 136241241 small insertion probably benign
R3704:Asap3 UTSW 4 136241241 small insertion probably benign
R3705:Asap3 UTSW 4 136241241 small insertion probably benign
R3754:Asap3 UTSW 4 136229455 splice site probably null
R3773:Asap3 UTSW 4 136227575 missense probably benign 0.22
R3911:Asap3 UTSW 4 136229457 splice site probably benign
R4570:Asap3 UTSW 4 136240185 missense probably damaging 0.99
R4879:Asap3 UTSW 4 136242664 missense probably benign 0.04
R5394:Asap3 UTSW 4 136241259 missense probably benign 0.00
R5914:Asap3 UTSW 4 136241409 missense probably benign 0.18
R6208:Asap3 UTSW 4 136241197 missense probably benign
R6214:Asap3 UTSW 4 136241425 missense possibly damaging 0.80
R6495:Asap3 UTSW 4 136228479 splice site probably null
R6577:Asap3 UTSW 4 136238230 splice site probably null
R6823:Asap3 UTSW 4 136227572 missense possibly damaging 0.95
R7067:Asap3 UTSW 4 136241362 splice site probably null
R7081:Asap3 UTSW 4 136241570 critical splice donor site probably null
R7471:Asap3 UTSW 4 136233646 missense possibly damaging 0.71
R8035:Asap3 UTSW 4 136241203 missense probably benign 0.09
R8398:Asap3 UTSW 4 136234393 missense probably benign
Z1176:Asap3 UTSW 4 136240201 critical splice donor site probably benign
Z1176:Asap3 UTSW 4 136241503 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCAGGGTCTGAGAGGGATC -3'
(R):5'- TCCAAGGCTAACCCATTTTACAG -3'

Sequencing Primer
(F):5'- CTGAGAGGGATCTGGTGTCAG -3'
(R):5'- GGCTAACCCATTTTACAGACAAGG -3'
Posted On2016-10-05