Incidental Mutation 'R0479:Rabepk'
ID43240
Institutional Source Beutler Lab
Gene Symbol Rabepk
Ensembl Gene ENSMUSG00000070953
Gene NameRab9 effector protein with kelch motifs
Synonyms
MMRRC Submission 038679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R0479 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location34777556-34799912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34785580 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 179 (H179Q)
Ref Sequence ENSEMBL: ENSMUSP00000122360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113086] [ENSMUST00000118108] [ENSMUST00000140663] [ENSMUST00000141099] [ENSMUST00000145903]
Predicted Effect probably benign
Transcript: ENSMUST00000047963
SMART Domains Protein: ENSMUSP00000037746
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 5 51 6.7e-13 PFAM
Pfam:Kelch_4 5 58 2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113086
AA Change: H120Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108709
Gene: ENSMUSG00000070953
AA Change: H120Q

DomainStartEndE-ValueType
Pfam:Kelch_2 30 82 5e-15 PFAM
Pfam:Kelch_4 30 86 6.7e-10 PFAM
Pfam:Kelch_3 47 96 1e-12 PFAM
Pfam:Kelch_4 87 140 4.6e-7 PFAM
Pfam:Kelch_3 98 150 1.6e-9 PFAM
Pfam:Kelch_5 138 174 6.2e-8 PFAM
Pfam:Kelch_1 141 186 8.3e-7 PFAM
Pfam:Kelch_4 141 190 2.3e-10 PFAM
Pfam:Kelch_6 141 190 4.1e-10 PFAM
Pfam:Kelch_3 151 200 3.5e-8 PFAM
Pfam:Kelch_5 188 225 1.8e-7 PFAM
Pfam:Kelch_1 191 233 2.8e-9 PFAM
Pfam:Kelch_4 193 240 9.4e-9 PFAM
Pfam:Kelch_3 201 250 6.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118108
AA Change: H171Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113099
Gene: ENSMUSG00000070953
AA Change: H171Q

DomainStartEndE-ValueType
Pfam:Kelch_2 30 82 2.8e-16 PFAM
Pfam:Kelch_4 30 82 3.7e-6 PFAM
Pfam:Kelch_3 99 147 8.2e-9 PFAM
Pfam:Kelch_4 138 191 2.7e-6 PFAM
Pfam:Kelch_3 149 201 7.9e-9 PFAM
Pfam:Kelch_5 189 225 2.8e-7 PFAM
Pfam:Kelch_1 192 237 5.2e-6 PFAM
Pfam:Kelch_4 192 241 1.3e-9 PFAM
Pfam:Kelch_6 192 241 2.4e-9 PFAM
Pfam:Kelch_3 202 251 1.7e-7 PFAM
Pfam:Kelch_5 239 276 8.1e-7 PFAM
Pfam:Kelch_1 242 284 1.8e-8 PFAM
Pfam:Kelch_4 244 291 5.5e-8 PFAM
Pfam:Kelch_3 252 301 3.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140663
Predicted Effect probably benign
Transcript: ENSMUST00000141099
SMART Domains Protein: ENSMUSP00000120887
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
low complexity region 49 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144113
Predicted Effect probably damaging
Transcript: ENSMUST00000145903
AA Change: H179Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122360
Gene: ENSMUSG00000070953
AA Change: H179Q

DomainStartEndE-ValueType
Pfam:Kelch_2 38 90 1.5e-17 PFAM
Pfam:Kelch_4 38 90 2.2e-7 PFAM
Pfam:Kelch_1 55 87 4.5e-7 PFAM
Pfam:Kelch_3 107 155 7e-10 PFAM
Pfam:Kelch_4 146 199 4e-7 PFAM
Pfam:Kelch_3 157 209 1.5e-10 PFAM
Pfam:Kelch_5 197 231 1e-8 PFAM
Pfam:Kelch_4 200 249 3.4e-9 PFAM
Pfam:Kelch_5 247 284 5.1e-8 PFAM
Pfam:Kelch_1 250 292 2.9e-9 PFAM
Pfam:Kelch_6 250 301 1.2e-8 PFAM
Meta Mutation Damage Score 0.5513 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 98% (105/107)
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,145 V269A probably benign Het
Acsl1 G A 8: 46,531,072 G543R probably damaging Het
Adam18 T C 8: 24,651,822 N244D probably benign Het
Adgra3 C T 5: 49,990,265 V478M probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Arhgef10 A T 8: 14,991,070 E723V probably damaging Het
Arid3a C A 10: 79,951,294 N519K possibly damaging Het
Atrn T A 2: 130,999,165 Y1162* probably null Het
Cacng5 T A 11: 107,877,951 N172Y probably benign Het
Cct8 C T 16: 87,487,706 V198M probably damaging Het
Cep192 G A 18: 67,858,018 S1857N probably damaging Het
Cherp A T 8: 72,463,147 D657E possibly damaging Het
Clca2 T G 3: 145,090,849 D199A probably damaging Het
Cops7b A G 1: 86,605,076 T219A probably benign Het
Crb1 C T 1: 139,198,614 M1392I probably damaging Het
Csf3r A C 4: 126,043,823 E833D probably damaging Het
Cutc A G 19: 43,768,216 E247G probably damaging Het
Cyp2c38 A G 19: 39,463,005 L17P probably damaging Het
D430042O09Rik T C 7: 125,843,346 L809S probably benign Het
D5Ertd615e T A 5: 45,163,454 noncoding transcript Het
Ddx60 G T 8: 61,969,657 G643W probably damaging Het
Depdc1a C T 3: 159,520,860 T268I probably damaging Het
Dgke T C 11: 89,052,470 E231G probably benign Het
Dhrs7b T A 11: 60,855,687 probably benign Het
Dll3 A G 7: 28,301,549 V27A probably damaging Het
Dnmt3c T A 2: 153,714,941 probably null Het
Duox1 T C 2: 122,346,380 F1461L probably damaging Het
Enpep A G 3: 129,312,674 V301A possibly damaging Het
Eny2 T A 15: 44,435,604 probably null Het
Esr1 A G 10: 4,997,911 D488G probably damaging Het
Ets1 A G 9: 32,730,180 K110E probably damaging Het
Eya2 T A 2: 165,715,956 Y157* probably null Het
F830045P16Rik T G 2: 129,472,688 D223A possibly damaging Het
Fbxo18 A G 2: 11,758,419 Y475H probably damaging Het
Fbxo39 T C 11: 72,317,593 I257T probably damaging Het
Fkbp10 T C 11: 100,415,914 V23A probably damaging Het
Foxp3 A G X: 7,587,344 I128V possibly damaging Het
Fzd7 T C 1: 59,483,708 F250S probably damaging Het
Gaa A G 11: 119,281,236 T722A possibly damaging Het
Gemin5 A G 11: 58,139,551 V816A probably benign Het
Glb1l3 T A 9: 26,829,093 T314S probably benign Het
H2-Ab1 A G 17: 34,264,968 E101G possibly damaging Het
Hydin A C 8: 110,599,088 T4710P probably damaging Het
Ica1 C T 6: 8,754,627 V48M probably damaging Het
Ica1 T C 6: 8,754,683 Y29C probably damaging Het
Ints7 T A 1: 191,614,554 probably null Het
Iqub T C 6: 24,505,810 E33G probably benign Het
Itgb1bp2 T A X: 101,449,200 C10S probably damaging Het
Kcnd1 T A X: 7,831,222 I391N possibly damaging Het
Kdm8 T C 7: 125,452,640 L135P probably damaging Het
Ksr1 T C 11: 79,025,283 D574G probably damaging Het
Lama5 C T 2: 180,184,457 R2331H probably benign Het
Larp1 C A 11: 58,042,820 N357K possibly damaging Het
Lgi3 C T 14: 70,534,552 probably benign Het
Lmbrd1 T A 1: 24,746,797 probably benign Het
Methig1 A T 15: 100,374,944 K53* probably null Het
Mfap3 T A 11: 57,529,643 I150N probably damaging Het
Mug1 A T 6: 121,840,227 Q85L probably benign Het
Npl A G 1: 153,515,409 V200A probably damaging Het
Nuf2 A T 1: 169,498,934 probably benign Het
Obscn A G 11: 59,112,707 V1255A probably damaging Het
Olfr186 C T 16: 59,027,128 V260M possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr916 T C 9: 38,658,182 D70G probably damaging Het
P2rx1 T C 11: 73,012,961 V283A probably damaging Het
Pex2 C A 3: 5,561,295 L151F probably damaging Het
Pias1 A G 9: 62,893,118 probably benign Het
Pmfbp1 A T 8: 109,530,473 probably benign Het
Pogz A G 3: 94,876,636 K545E possibly damaging Het
Ppp3cb T C 14: 20,503,241 probably null Het
Prl G A 13: 27,064,928 D189N probably damaging Het
Prpf6 A G 2: 181,651,127 N794S probably benign Het
Prr36 G A 8: 4,213,930 Q579* probably null Het
Ptprq A T 10: 107,643,994 Y1138* probably null Het
Rest T C 5: 77,282,751 S1006P probably damaging Het
Rimklb A C 6: 122,464,216 probably benign Het
Rnpepl1 T C 1: 92,918,865 probably benign Het
Sacs T A 14: 61,191,479 L329Q probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Setd5 A T 6: 113,115,033 I272F probably damaging Het
Sgk1 G T 10: 21,996,310 A262S probably benign Het
Skint2 G A 4: 112,624,041 V34I possibly damaging Het
Skint5 G C 4: 113,655,672 Q888E unknown Het
Slc4a3 T C 1: 75,551,828 probably benign Het
Sox10 T C 15: 79,163,319 E133G probably damaging Het
Spryd3 G A 15: 102,130,400 R129* probably null Het
Stag1 T A 9: 100,928,091 N782K probably benign Het
Stam T C 2: 14,117,495 L132P probably damaging Het
Stard9 T A 2: 120,697,596 S1445T probably damaging Het
Syt5 C T 7: 4,543,109 R94Q probably benign Het
Tbc1d23 A T 16: 57,171,814 H594Q probably damaging Het
Tecta T A 9: 42,337,939 I1871F probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Thrb T C 14: 18,033,643 F469L probably damaging Het
Trove2 A T 1: 143,757,751 D536E possibly damaging Het
Tyr T C 7: 87,493,221 S44G possibly damaging Het
Usp20 T A 2: 31,017,475 V673E probably benign Het
Usp28 T C 9: 49,037,213 S873P probably damaging Het
Usp43 C T 11: 67,897,274 V306M possibly damaging Het
Wdr17 G T 8: 54,651,421 probably null Het
Wsb2 T G 5: 117,376,679 probably benign Het
Xkrx A T X: 134,150,966 L312Q probably damaging Het
Other mutations in Rabepk
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0066:Rabepk UTSW 2 34795306 missense possibly damaging 0.89
R2152:Rabepk UTSW 2 34784550 missense possibly damaging 0.94
R2233:Rabepk UTSW 2 34795234 missense possibly damaging 0.96
R2234:Rabepk UTSW 2 34795234 missense possibly damaging 0.96
R4634:Rabepk UTSW 2 34780740 missense probably damaging 1.00
R4962:Rabepk UTSW 2 34780657 missense probably damaging 1.00
R7088:Rabepk UTSW 2 34785699 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTTACCTTTGAGCCACACCCAAC -3'
(R):5'- TCTCTGGACTAGAAGACAGGACGTG -3'

Sequencing Primer
(F):5'- atccgcctgcttccacc -3'
(R):5'- GACGTGGAGCACACCAG -3'
Posted On2013-05-23