Incidental Mutation 'R5497:Zfp980'
ID432401
Institutional Source Beutler Lab
Gene Symbol Zfp980
Ensembl Gene ENSMUSG00000058186
Gene Namezinc finger protein 980
SynonymsGm13242
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R5497 (G1)
Quality Score204
Status Not validated
Chromosome4
Chromosomal Location145670685-145704441 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145701447 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 249 (K249E)
Ref Sequence ENSEMBL: ENSMUSP00000137589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105738] [ENSMUST00000180014]
Predicted Effect probably damaging
Transcript: ENSMUST00000105738
AA Change: K249E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101364
Gene: ENSMUSG00000058186
AA Change: K249E

DomainStartEndE-ValueType
KRAB 28 90 1.46e-16 SMART
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 251 273 1.84e-4 SMART
ZnF_C2H2 279 301 3.49e-5 SMART
ZnF_C2H2 307 329 1.95e-3 SMART
ZnF_C2H2 335 357 5.67e-5 SMART
ZnF_C2H2 363 385 1.98e-4 SMART
ZnF_C2H2 391 413 1.98e-4 SMART
ZnF_C2H2 419 441 2.4e-3 SMART
ZnF_C2H2 447 469 1.22e-4 SMART
ZnF_C2H2 475 497 5.67e-5 SMART
ZnF_C2H2 503 525 1.98e-4 SMART
ZnF_C2H2 531 553 6.88e-4 SMART
ZnF_C2H2 559 581 1.58e-3 SMART
ZnF_C2H2 587 609 1.22e-4 SMART
ZnF_C2H2 615 635 1.26e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180014
AA Change: K249E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137589
Gene: ENSMUSG00000058186
AA Change: K249E

DomainStartEndE-ValueType
KRAB 28 90 1.46e-16 SMART
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 251 273 1.84e-4 SMART
ZnF_C2H2 279 301 3.49e-5 SMART
ZnF_C2H2 307 329 1.95e-3 SMART
ZnF_C2H2 335 357 5.67e-5 SMART
ZnF_C2H2 363 385 1.98e-4 SMART
ZnF_C2H2 391 413 1.98e-4 SMART
ZnF_C2H2 419 441 2.4e-3 SMART
ZnF_C2H2 447 469 1.22e-4 SMART
ZnF_C2H2 475 497 5.67e-5 SMART
ZnF_C2H2 503 525 1.98e-4 SMART
ZnF_C2H2 531 553 6.88e-4 SMART
ZnF_C2H2 559 581 1.58e-3 SMART
ZnF_C2H2 587 609 1.22e-4 SMART
ZnF_C2H2 615 635 1.26e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180968
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Other mutations in Zfp980
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Zfp980 APN 4 145701991 missense probably benign 0.00
R0164:Zfp980 UTSW 4 145701997 missense probably benign
R0164:Zfp980 UTSW 4 145701997 missense probably benign
R1186:Zfp980 UTSW 4 145702083 missense probably benign
R1761:Zfp980 UTSW 4 145702042 missense probably damaging 1.00
R3726:Zfp980 UTSW 4 145702083 missense probably benign
R4049:Zfp980 UTSW 4 145702600 missense probably damaging 1.00
R4467:Zfp980 UTSW 4 145702083 missense probably benign
R4610:Zfp980 UTSW 4 145702083 missense probably benign
R4622:Zfp980 UTSW 4 145702057 missense probably damaging 1.00
R4873:Zfp980 UTSW 4 145702083 missense probably benign
R5008:Zfp980 UTSW 4 145702083 missense probably benign
R5027:Zfp980 UTSW 4 145702083 missense probably benign
R5995:Zfp980 UTSW 4 145701909 nonsense probably null
R6125:Zfp980 UTSW 4 145702638 makesense probably null
R7353:Zfp980 UTSW 4 145702144 missense probably benign 0.06
R7675:Zfp980 UTSW 4 145701594 nonsense probably null
R7939:Zfp980 UTSW 4 145702012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTAGTCTCAATCAAGGAACCC -3'
(R):5'- ACTCACTGCATTTGTAAGGTTTCTC -3'

Sequencing Primer
(F):5'- TGAGGTTTTGGTTTCTAGACAAAAC -3'
(R):5'- CTCCTGTATGAATTCTCTGATGAAC -3'
Posted On2016-10-05