Incidental Mutation 'R5497:Srm'
ID432402
Institutional Source Beutler Lab
Gene Symbol Srm
Ensembl Gene ENSMUSG00000006442
Gene Namespermidine synthase
SynonymsSpdST, SpdSy
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location148591503-148594993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 148594109 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 264 (Q264H)
Ref Sequence ENSEMBL: ENSMUSP00000006611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006611]
Predicted Effect probably benign
Transcript: ENSMUST00000006611
AA Change: Q264H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006611
Gene: ENSMUSG00000006442
AA Change: Q264H

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:Spermine_synth 19 262 6.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152701
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The polyamines putrescine, spermine, and spermidine are ubiquitous polycationic mediators of cell growth and differentiation. Spermidine synthase is one of four enzymes in the polyamine-biosynthetic pathway and carries out the final step of spermidine biosynthesis. This enzyme catalyzes the conversion of putrescine to spermidine using decarboxylated S-adenosylmethionine as the cofactor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Srm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02708:Srm APN 4 148593346 missense probably benign 0.28
IGL02961:Srm APN 4 148594129 missense possibly damaging 0.73
IGL03085:Srm APN 4 148593381 missense probably damaging 0.97
R0233:Srm UTSW 4 148593372 missense probably damaging 1.00
R0233:Srm UTSW 4 148593372 missense probably damaging 1.00
R1541:Srm UTSW 4 148593424 missense probably damaging 1.00
R2040:Srm UTSW 4 148593996 missense possibly damaging 0.61
R2155:Srm UTSW 4 148592491 missense probably benign 0.28
R2519:Srm UTSW 4 148591504 splice site probably null
R4965:Srm UTSW 4 148594183 missense possibly damaging 0.51
R7803:Srm UTSW 4 148593945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACTACGCCTACTGTAGC -3'
(R):5'- TCACAGTGGCACCTGGATTC -3'

Sequencing Primer
(F):5'- GGACTACGCCTACTGTAGCATTCC -3'
(R):5'- GGCACCTGGATTCAGCTTATGTC -3'
Posted On2016-10-05