Incidental Mutation 'R5497:Hsd3b7'
ID432418
Institutional Source Beutler Lab
Gene Symbol Hsd3b7
Ensembl Gene ENSMUSG00000042289
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Synonyms
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127800604-127803802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127801888 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 99 (Y99C)
Ref Sequence ENSEMBL: ENSMUSP00000145613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000106267] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000125188] [ENSMUST00000138432] [ENSMUST00000139068] [ENSMUST00000154987] [ENSMUST00000155005] [ENSMUST00000206674]
Predicted Effect probably damaging
Transcript: ENSMUST00000046863
AA Change: Y126C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289
AA Change: Y126C

DomainStartEndE-ValueType
Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047075
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106267
SMART Domains Protein: ENSMUSP00000101874
Gene: ENSMUSG00000030806

DomainStartEndE-ValueType
SynN 24 145 1.99e-44 SMART
t_SNARE 186 253 4.32e-24 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106271
AA Change: Y126C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289
AA Change: Y126C

DomainStartEndE-ValueType
Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106272
AA Change: Y126C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289
AA Change: Y126C

DomainStartEndE-ValueType
Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124631
Predicted Effect probably damaging
Transcript: ENSMUST00000125188
AA Change: Y99C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136597
Predicted Effect probably benign
Transcript: ENSMUST00000136823
Predicted Effect probably benign
Transcript: ENSMUST00000138432
SMART Domains Protein: ENSMUSP00000114536
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 18 78 1.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139068
AA Change: Y74C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121246
Gene: ENSMUSG00000042289
AA Change: Y74C

DomainStartEndE-ValueType
Pfam:3Beta_HSD 13 55 2.7e-13 PFAM
Pfam:3Beta_HSD 53 100 3.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144748
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Predicted Effect probably benign
Transcript: ENSMUST00000155005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206995
Predicted Effect probably benign
Transcript: ENSMUST00000206674
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which is involved in the initial stages of the synthesis of bile acids from cholesterol and a member of the short-chain dehydrogenase/reductase superfamily. The encoded protein is a membrane-associated endoplasmic reticulum protein which is active against 7-alpha hydrosylated sterol substrates. Mutations in this gene are associated with a congenital bile acid synthesis defect which leads to neonatal cholestasis, a form of progressive liver disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, dwarfism, growth retardation, oily and scaly skin, and altered bile salt and lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Hsd3b7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hsd3b7 APN 7 127802972 missense probably damaging 1.00
IGL01589:Hsd3b7 APN 7 127802864 missense probably damaging 1.00
IGL03037:Hsd3b7 APN 7 127801150 missense probably damaging 1.00
irritated UTSW 7 127801134 nonsense probably null
R0518:Hsd3b7 UTSW 7 127803079 missense probably benign 0.01
R1801:Hsd3b7 UTSW 7 127803034 missense possibly damaging 0.82
R2860:Hsd3b7 UTSW 7 127802270 missense probably damaging 1.00
R2861:Hsd3b7 UTSW 7 127802270 missense probably damaging 1.00
R4059:Hsd3b7 UTSW 7 127801545 missense probably damaging 1.00
R5129:Hsd3b7 UTSW 7 127801134 nonsense probably null
R6143:Hsd3b7 UTSW 7 127801232 missense probably damaging 1.00
R6358:Hsd3b7 UTSW 7 127801537 missense probably damaging 0.96
R6984:Hsd3b7 UTSW 7 127801545 missense probably damaging 1.00
R7067:Hsd3b7 UTSW 7 127800716 critical splice donor site probably null
R7910:Hsd3b7 UTSW 7 127801247 critical splice donor site probably null
R8172:Hsd3b7 UTSW 7 127802374 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACTGCTGTCGAACCCTGTC -3'
(R):5'- AAGTCCCATCTTTGCAGTGTACC -3'

Sequencing Primer
(F):5'- GAACCCTGTCCTGACCTGATG -3'
(R):5'- TTCCATTGGCCTCGAGGAC -3'
Posted On2016-10-05