Incidental Mutation 'R5497:Adarb1'
ID 432427
Institutional Source Beutler Lab
Gene Symbol Adarb1
Ensembl Gene ENSMUSG00000020262
Gene Name adenosine deaminase, RNA-specific, B1
Synonyms RED1, D10Bwg0447e, ADAR2, 1700057H01Rik
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5497 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 77290726-77418270 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77325889 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000101046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020496] [ENSMUST00000098374] [ENSMUST00000105404] [ENSMUST00000105406] [ENSMUST00000126073] [ENSMUST00000144547]
AlphaFold Q91ZS8
Predicted Effect probably damaging
Transcript: ENSMUST00000020496
AA Change: D2G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020496
Gene: ENSMUSG00000020262
AA Change: D2G

DomainStartEndE-ValueType
DSRM 79 143 1.9e-22 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 5.8e-21 SMART
ADEAMc 322 698 2.1e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098374
AA Change: D2G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095976
Gene: ENSMUSG00000020262
AA Change: D2G

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105404
AA Change: D2G
Predicted Effect probably damaging
Transcript: ENSMUST00000105406
AA Change: D2G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101046
Gene: ENSMUSG00000020262
AA Change: D2G

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect unknown
Transcript: ENSMUST00000126073
AA Change: D2G
Predicted Effect unknown
Transcript: ENSMUST00000144547
AA Change: D2G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156583
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a double-stranded-RNA-specific adenosine deaminase that is involved in editing pre-mRNAs by site-specific conversion of adenosine (A) to inosine (I). Substrates for this enzyme include ionotropic glutamate receptors (GluR2-6) and serotonin receptor (5HT2C). Studies in rodents have shown that this protein can modify its own pre-mRNA by A->I editing to create a novel acceptor splice site, alternative splicing to which results in down regulation of its protein expression. Additional splicing events result in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in progressive seizure susceptibility and death within 20 days of age. Mice homozygous for a conditional allele activated in neurons exhibit motor neuron degeneration, motor function abnormalities, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Adarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Adarb1 APN 10 77322490 missense probably damaging 1.00
IGL01996:Adarb1 APN 10 77322217 missense probably damaging 1.00
IGL02173:Adarb1 APN 10 77321825 missense probably damaging 1.00
IGL02214:Adarb1 APN 10 77322301 missense probably damaging 0.99
IGL02399:Adarb1 APN 10 77295754 missense probably benign 0.02
IGL02699:Adarb1 APN 10 77322019 missense probably benign
IGL02867:Adarb1 APN 10 77313541 missense probably benign 0.01
IGL02889:Adarb1 APN 10 77313541 missense probably benign 0.01
IGL03133:Adarb1 APN 10 77325896 start gained probably benign
R1806:Adarb1 UTSW 10 77322265 missense probably damaging 0.98
R1834:Adarb1 UTSW 10 77317231 splice site probably benign
R2174:Adarb1 UTSW 10 77295798 missense probably benign 0.35
R2233:Adarb1 UTSW 10 77317349 missense probably damaging 1.00
R2234:Adarb1 UTSW 10 77317349 missense probably damaging 1.00
R2908:Adarb1 UTSW 10 77313403 critical splice donor site probably null
R3106:Adarb1 UTSW 10 77321757 missense probably damaging 1.00
R5104:Adarb1 UTSW 10 77322287 missense probably damaging 1.00
R5134:Adarb1 UTSW 10 77325845 intron probably benign
R5869:Adarb1 UTSW 10 77325616 intron probably benign
R6168:Adarb1 UTSW 10 77322319 missense probably damaging 1.00
R7372:Adarb1 UTSW 10 77295878 critical splice acceptor site probably null
R7575:Adarb1 UTSW 10 77303295 missense probably damaging 0.99
R7885:Adarb1 UTSW 10 77295708 missense possibly damaging 0.50
R9227:Adarb1 UTSW 10 77321792 missense probably damaging 1.00
R9230:Adarb1 UTSW 10 77321792 missense probably damaging 1.00
R9350:Adarb1 UTSW 10 77322433 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAAACTCTAGATAGGTGGCTGTAAG -3'
(R):5'- ATTCCTTCTCAGATGGCAGGC -3'

Sequencing Primer
(F):5'- CCACAGTAAATATTGAAGCCTGG -3'
(R):5'- TCAGATGGCAGGCTCCTTACAG -3'
Posted On 2016-10-05