Incidental Mutation 'R5497:Apaf1'
ID432428
Institutional Source Beutler Lab
Gene Symbol Apaf1
Ensembl Gene ENSMUSG00000019979
Gene Nameapoptotic peptidase activating factor 1
SynonymsApaf1l, 6230400I06Rik
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location90989311-91082770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90999656 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1098 (A1098V)
Ref Sequence ENSEMBL: ENSMUSP00000124134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]
Predicted Effect probably damaging
Transcript: ENSMUST00000020157
AA Change: A1109V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: A1109V

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.3e-22 PFAM
Pfam:NB-ARC 129 414 1.7e-77 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159110
AA Change: A1109V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: A1109V

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.4e-21 PFAM
Pfam:NB-ARC 129 414 6.9e-71 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161095
Predicted Effect probably damaging
Transcript: ENSMUST00000162618
AA Change: A1098V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: A1098V

DomainStartEndE-ValueType
Pfam:CARD 6 90 1.1e-20 PFAM
Pfam:NB-ARC 118 403 8.8e-72 PFAM
WD40 593 632 1.35e-5 SMART
WD40 635 674 1.04e-11 SMART
WD40 677 718 2.98e-7 SMART
WD40 721 760 9.88e-13 SMART
WD40 769 814 1.28e1 SMART
WD40 817 857 1.43e0 SMART
WD40 860 899 3.24e-8 SMART
WD40 941 978 2.57e0 SMART
WD40 981 1020 1.09e-5 SMART
WD40 1022 1060 2.09e-2 SMART
WD40 1063 1102 2.93e-6 SMART
WD40 1105 1144 8.55e-8 SMART
WD40 1157 1193 4.55e-3 SMART
Blast:WD40 1196 1235 5e-18 BLAST
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Apaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Apaf1 APN 10 91023788 missense probably damaging 0.99
IGL00819:Apaf1 APN 10 90997340 splice site probably null
IGL01481:Apaf1 APN 10 91031588 missense possibly damaging 0.84
IGL01713:Apaf1 APN 10 91061832 splice site probably benign
IGL01715:Apaf1 APN 10 91058354 missense probably benign 0.20
IGL02152:Apaf1 APN 10 91061819 missense probably benign 0.24
IGL02331:Apaf1 APN 10 91059619 missense probably damaging 1.00
IGL03071:Apaf1 APN 10 90997255 missense possibly damaging 0.88
IGL03101:Apaf1 APN 10 91031559 missense possibly damaging 0.89
IGL03244:Apaf1 APN 10 91049349 splice site probably benign
Mayhem UTSW 10 90999719 missense probably damaging 0.99
Wipeout UTSW 10 91056000 missense probably damaging 1.00
R0520:Apaf1 UTSW 10 91079989 missense probably damaging 0.99
R0600:Apaf1 UTSW 10 91060052 missense probably damaging 1.00
R0607:Apaf1 UTSW 10 91009203 missense probably damaging 1.00
R0688:Apaf1 UTSW 10 91061705 missense possibly damaging 0.94
R0734:Apaf1 UTSW 10 91037021 missense probably benign 0.02
R1256:Apaf1 UTSW 10 91058406 missense probably benign
R1459:Apaf1 UTSW 10 91062160 missense probably benign 0.00
R1485:Apaf1 UTSW 10 91060243 missense probably benign 0.02
R1511:Apaf1 UTSW 10 91060185 missense possibly damaging 0.81
R1531:Apaf1 UTSW 10 91054521 missense probably damaging 1.00
R1705:Apaf1 UTSW 10 91067271 splice site probably benign
R1919:Apaf1 UTSW 10 91077614 nonsense probably null
R1925:Apaf1 UTSW 10 90999719 missense probably damaging 0.99
R2001:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2002:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2006:Apaf1 UTSW 10 91061772 missense probably damaging 1.00
R2043:Apaf1 UTSW 10 91037028 missense probably damaging 1.00
R2073:Apaf1 UTSW 10 91031694 nonsense probably null
R2101:Apaf1 UTSW 10 91060080 missense probably benign 0.26
R2130:Apaf1 UTSW 10 91060165 nonsense probably null
R2153:Apaf1 UTSW 10 91048090 missense probably damaging 1.00
R2377:Apaf1 UTSW 10 91079893 missense possibly damaging 0.95
R2421:Apaf1 UTSW 10 91020723 missense probably damaging 1.00
R3835:Apaf1 UTSW 10 91059587 missense probably benign 0.07
R4750:Apaf1 UTSW 10 91060188 missense probably damaging 1.00
R5100:Apaf1 UTSW 10 90997287 missense probably benign
R5135:Apaf1 UTSW 10 91060094 missense probably damaging 1.00
R5511:Apaf1 UTSW 10 91054392 missense probably damaging 1.00
R5659:Apaf1 UTSW 10 91062153 nonsense probably null
R5730:Apaf1 UTSW 10 91020771 missense possibly damaging 0.62
R6176:Apaf1 UTSW 10 91059571 critical splice donor site probably null
R6242:Apaf1 UTSW 10 91062163 missense probably damaging 1.00
R6292:Apaf1 UTSW 10 90991563 missense possibly damaging 0.86
R6376:Apaf1 UTSW 10 91023811 missense probably damaging 1.00
R6534:Apaf1 UTSW 10 91056000 missense probably damaging 1.00
R6975:Apaf1 UTSW 10 91020734 missense probably damaging 0.97
R7218:Apaf1 UTSW 10 91037002 missense probably damaging 1.00
R7369:Apaf1 UTSW 10 91001036 missense probably damaging 0.97
R7409:Apaf1 UTSW 10 91067246 missense probably damaging 1.00
R7413:Apaf1 UTSW 10 90995680 missense probably benign 0.28
R7418:Apaf1 UTSW 10 91023835 missense probably benign 0.09
R7423:Apaf1 UTSW 10 91059606 missense probably damaging 1.00
R7488:Apaf1 UTSW 10 91054380 missense probably benign 0.35
R7765:Apaf1 UTSW 10 91023782 missense probably benign 0.34
R7913:Apaf1 UTSW 10 91060271 missense probably damaging 0.99
R7914:Apaf1 UTSW 10 91060233 missense probably damaging 1.00
R7922:Apaf1 UTSW 10 90999753 missense probably benign
R8131:Apaf1 UTSW 10 91077558 missense possibly damaging 0.93
R8158:Apaf1 UTSW 10 91059658 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCACAGTGACTCATGCAG -3'
(R):5'- GGGCTTTGCACTCACTAAAC -3'

Sequencing Primer
(F):5'- ACAGTGACTCATGCAGGTCCC -3'
(R):5'- CTTGAAGTTCTACGTAGCCCAAG -3'
Posted On2016-10-05